ID: 941892169

View in Genome Browser
Species Human (GRCh38)
Location 2:170594031-170594053
Sequence CCTAACATACACACTGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941892162_941892169 19 Left 941892162 2:170593989-170594011 CCACTTTGATCATGTTACCTTCC No data
Right 941892169 2:170594031-170594053 CCTAACATACACACTGTTTATGG No data
941892166_941892169 -6 Left 941892166 2:170594014-170594036 CCTTTGGAAAATTATACCCTAAC No data
Right 941892169 2:170594031-170594053 CCTAACATACACACTGTTTATGG No data
941892164_941892169 2 Left 941892164 2:170594006-170594028 CCTTCCTTCCTTTGGAAAATTAT No data
Right 941892169 2:170594031-170594053 CCTAACATACACACTGTTTATGG No data
941892161_941892169 28 Left 941892161 2:170593980-170594002 CCTTCTCATCCACTTTGATCATG No data
Right 941892169 2:170594031-170594053 CCTAACATACACACTGTTTATGG No data
941892165_941892169 -2 Left 941892165 2:170594010-170594032 CCTTCCTTTGGAAAATTATACCC No data
Right 941892169 2:170594031-170594053 CCTAACATACACACTGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941892169 Original CRISPR CCTAACATACACACTGTTTA TGG Intronic
No off target data available for this crispr