ID: 941892498

View in Genome Browser
Species Human (GRCh38)
Location 2:170596587-170596609
Sequence CCACCCATGAGGTTTATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941892490_941892498 13 Left 941892490 2:170596551-170596573 CCATGAAATTCCTTAATTCTGAC No data
Right 941892498 2:170596587-170596609 CCACCCATGAGGTTTATAGGGGG No data
941892491_941892498 3 Left 941892491 2:170596561-170596583 CCTTAATTCTGACTACATGTTTT No data
Right 941892498 2:170596587-170596609 CCACCCATGAGGTTTATAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941892498 Original CRISPR CCACCCATGAGGTTTATAGG GGG Intronic
No off target data available for this crispr