ID: 941893922

View in Genome Browser
Species Human (GRCh38)
Location 2:170610620-170610642
Sequence TCCCACTACATCCTGCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941893920_941893922 22 Left 941893920 2:170610575-170610597 CCAGTTATGGTAGCTTTCTCAAA No data
Right 941893922 2:170610620-170610642 TCCCACTACATCCTGCTTGATGG No data
941893919_941893922 23 Left 941893919 2:170610574-170610596 CCCAGTTATGGTAGCTTTCTCAA No data
Right 941893922 2:170610620-170610642 TCCCACTACATCCTGCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941893922 Original CRISPR TCCCACTACATCCTGCTTGA TGG Intronic
No off target data available for this crispr