ID: 941895040

View in Genome Browser
Species Human (GRCh38)
Location 2:170620677-170620699
Sequence CTGTGTGCACAGATCTACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941895040_941895043 14 Left 941895040 2:170620677-170620699 CCCGGGTAGATCTGTGCACACAG No data
Right 941895043 2:170620714-170620736 TGTTGAAGAACCCTGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941895040 Original CRISPR CTGTGTGCACAGATCTACCC GGG (reversed) Intronic
No off target data available for this crispr