ID: 941905641

View in Genome Browser
Species Human (GRCh38)
Location 2:170715003-170715025
Sequence CCCAAGCGCGGGTCTCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941905641 Original CRISPR CCCAAGCGCGGGTCTCCAGG CGG Intergenic
900109936 1:1001174-1001196 CCCAGGCCAGGCTCTCCAGGGGG - Intergenic
900115406 1:1025878-1025900 CCCAACCCCGGGGCTCCTGGTGG + Intronic
900379875 1:2378442-2378464 CCCAACCGGGGGCCTCCACGGGG - Intronic
900679877 1:3910894-3910916 GCCAAGGGTGGTTCTCCAGGCGG - Intergenic
906299932 1:44674407-44674429 CCAGAGCACGGGTCTCCAGCCGG + Exonic
911589436 1:99729602-99729624 CCGGAAAGCGGGTCTCCAGGTGG + Intronic
915164160 1:153939355-153939377 CCCAAGCCTGGGGCTCCAGAGGG + Intronic
917929138 1:179811948-179811970 CCCAAGTCCAGGTCTCCAGCTGG - Intronic
919486945 1:198157384-198157406 CCCGAGCGAGGGTATCCCGGAGG - Intronic
923098394 1:230793459-230793481 CCCAAAGGCTGGGCTCCAGGTGG + Intronic
924172444 1:241356760-241356782 CCCCGGCGCGGGGCTCCCGGGGG + Intronic
1066037524 10:31508516-31508538 CCCAACCTCAGGCCTCCAGGAGG + Intronic
1067775766 10:49163877-49163899 CCCAAGCGCATGACTCCATGAGG + Intronic
1070669660 10:78369085-78369107 CCCCAGCGAGGGCTTCCAGGAGG - Intergenic
1074105132 10:110383499-110383521 TCCAAGTGCTGGTCTCAAGGAGG + Intergenic
1076726546 10:132416645-132416667 CCCAGGCTCGGGTCTCCACGGGG + Intronic
1084165588 11:67373425-67373447 CCCCGGCGCGGGGCTCCCGGGGG + Intronic
1086980965 11:93197681-93197703 GCCAAGCGCGGGGCCCCTGGAGG + Intronic
1089660265 11:119981096-119981118 CCCAAGCCTGGGTTTCCAGGTGG + Intergenic
1103734280 12:123049254-123049276 CCCAAGCGTGCTTGTCCAGGAGG + Intronic
1104390463 12:128387368-128387390 CCCAAGCCTGGTGCTCCAGGTGG - Intronic
1105329542 13:19402818-19402840 CAGAAGCGCCGGGCTCCAGGGGG - Intergenic
1113962411 13:114133096-114133118 CCCATGCTGGGGTCTGCAGGGGG - Intergenic
1113962431 13:114133139-114133161 CCCATGCCGGGGTCTGCAGGGGG - Intergenic
1113962450 13:114133181-114133203 CCCATGCCGGGGTCTGCAGGGGG - Intergenic
1113962468 13:114133222-114133244 CCCATGCCGGGGTCTGCAGGGGG - Intergenic
1113962485 13:114133260-114133282 CCCATGCCGGGGTCTGCAGGGGG - Intergenic
1113962568 13:114133460-114133482 CCCATGCTGGGGTCTGCAGGGGG - Intergenic
1113962603 13:114133537-114133559 CCCATGCCGGGGTCTGCAGGGGG - Intergenic
1113962622 13:114133578-114133600 CCCATGCCGGGGTCTGCAGGGGG - Intergenic
1113962690 13:114133736-114133758 CCCATGCCGGGGTCTGCAGGGGG - Intergenic
1113962724 13:114133816-114133838 CCCATGCCGGGGTCTGCAGGGGG - Intergenic
1113962741 13:114133855-114133877 CCCATGCTGGGGTCTGCAGGGGG - Intergenic
1119379493 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG + Intergenic
1121414736 14:93771561-93771583 CCCAAGCAGGGACCTCCAGGTGG + Intronic
1131699525 15:94918940-94918962 CCCAAGCACGGCTCCCCAGCTGG + Intergenic
1132105428 15:99059373-99059395 CCCAGGCGCGGGGAGCCAGGCGG + Intergenic
1132852462 16:2031008-2031030 CCCAAGCGCGGTTCTCACAGTGG - Intronic
1135745724 16:25015024-25015046 CCCGAGCGCCGCGCTCCAGGCGG - Intronic
1138360177 16:56421954-56421976 CCCAAGGGGGCCTCTCCAGGTGG - Intronic
1141377818 16:83548115-83548137 GCCAAGAGCAGGTGTCCAGGTGG + Intronic
1141621523 16:85238894-85238916 CCCAGGCCCGGGTGTGCAGGTGG - Intergenic
1142184679 16:88688853-88688875 CCCAAGAGCGGTTTTCCAGTGGG + Intergenic
1147989578 17:44324654-44324676 CGGAAGCGGGGGTCTCCGGGCGG - Intronic
1148157867 17:45433507-45433529 CCCAACCCTGGGTCCCCAGGAGG - Intronic
1151422872 17:74009883-74009905 CCCCAGCACTGGTGTCCAGGAGG + Intergenic
1151987737 17:77555128-77555150 CCAAATCGCGGGTCTCCACCTGG - Intergenic
1152904606 17:82963333-82963355 CCCCAGCGCGAACCTCCAGGAGG + Intronic
1161495833 19:4585062-4585084 CCCAGCCCCGGGGCTCCAGGCGG - Intergenic
1162416878 19:10543809-10543831 CCCGATCCCGGGTCGCCAGGCGG - Intergenic
1162905848 19:13823445-13823467 CACACTGGCGGGTCTCCAGGTGG - Exonic
1166948896 19:46413455-46413477 CCCCAGCCCGGGCCTCCAGTAGG + Exonic
927521920 2:23704060-23704082 CCCAACCCCGGGGCTCCAGCTGG + Intronic
930028990 2:47047000-47047022 CCCAGGCCAGGGTCTCCAGCAGG - Intronic
930247858 2:49003454-49003476 CCCAAGGGCAAGTCTGCAGGAGG - Intronic
936125640 2:109787297-109787319 CCCAAGGATGGGTCTCCACGTGG - Intergenic
936219053 2:110584171-110584193 CCCAAGGATGGGTCTCCACGTGG + Intergenic
938138186 2:128775994-128776016 CCCCAGCCAGGCTCTCCAGGGGG + Intergenic
938322057 2:130372315-130372337 CAGAAGCGCGGGGCTCCAGCGGG + Exonic
941905641 2:170715003-170715025 CCCAAGCGCGGGTCTCCAGGCGG + Intergenic
946173539 2:217909185-217909207 CCCAACCTCAGGTCTCCACGTGG - Intronic
1169331262 20:4718169-4718191 CCCAGCCGCGAGTCTCCATGTGG - Intergenic
1171784216 20:29448286-29448308 CTCATGCGCGGGTTTGCAGGCGG - Intergenic
1173564655 20:44030110-44030132 TCCAAGTGGGGGTTTCCAGGTGG - Intronic
1174481044 20:50831722-50831744 CCCAAGCCCAGGGCCCCAGGTGG - Intronic
1174606971 20:51768242-51768264 CCCGAGCGCCGGGCTCCGGGAGG + Intronic
1175813430 20:61871173-61871195 CTCTAGTGTGGGTCTCCAGGTGG + Intronic
1175936248 20:62515462-62515484 CCCACCTGCGGGTTTCCAGGTGG - Intergenic
1175991766 20:62793419-62793441 GCCAAGCGTGTGTCTCCATGTGG + Intergenic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1179492091 21:41747243-41747265 CCCAAGCTCAGGTCCCCAGCTGG + Intronic
1182753281 22:32658418-32658440 CCCAAGGCCCAGTCTCCAGGAGG - Intronic
1185129771 22:49032349-49032371 TCCATGCCCGGCTCTCCAGGGGG - Intergenic
949394698 3:3602477-3602499 CCCAAGCATGGATGTCCAGGAGG - Intergenic
952967477 3:38630258-38630280 CCCCAGCGTGGGCCCCCAGGGGG + Intronic
954743275 3:52771507-52771529 CCTAAGGGCGGATCTCTAGGTGG + Intergenic
968506074 4:972078-972100 CCCACGCTTGGGTCTCCTGGCGG + Intronic
970057332 4:11989501-11989523 CCTCAGTCCGGGTCTCCAGGTGG - Intergenic
984774289 4:183467215-183467237 CCCTAGCGAGGTTCTCCATGAGG - Intergenic
998906408 5:146909781-146909803 CCCAAGCTCTGGTTTCTAGGTGG + Intronic
1017246903 6:152236858-152236880 CCCAAGCGTGGGTCTGGTGGAGG - Exonic
1018983421 6:168617412-168617434 CCCAAGGACGGGTCTCCCAGGGG + Intronic
1019597324 7:1864170-1864192 CCCGGGCCAGGGTCTCCAGGAGG + Intronic
1019601031 7:1883917-1883939 CCCTGGCCCGGGTATCCAGGAGG - Intronic
1022325827 7:29331334-29331356 CCCAACCCCGGGTCTGGAGGGGG + Intronic
1022788821 7:33665879-33665901 CCCAAGCCCTGGTTTCCAGCAGG - Intergenic
1023703007 7:42911638-42911660 CCCCAGCGCAGGTCGCCGGGTGG + Intronic
1023868715 7:44251517-44251539 CCCAGGAGGGGCTCTCCAGGAGG + Intronic
1028755563 7:94429499-94429521 CCCAAGGGGGGGTCTAAAGGGGG + Intronic
1031027545 7:116696532-116696554 GCCAAGTGAGGGTCTCAAGGAGG - Intronic
1032344585 7:131106816-131106838 CCCAGGCGCAGGTTTCCAGAAGG - Intergenic
1034874503 7:154713416-154713438 CCCTAGTGAGGTTCTCCAGGAGG + Intronic
1040477082 8:47788260-47788282 CCCAAGGGCAAGTCTCCAGATGG + Intronic
1046009666 8:108530869-108530891 CCCAAGAGCTGATCTCCAAGAGG + Intergenic
1051840844 9:21396229-21396251 CCCAAGCGCGGGTCTCCTTGAGG + Intergenic
1053307079 9:36992352-36992374 CCCCAGATGGGGTCTCCAGGTGG + Intronic
1058876656 9:109250429-109250451 CCCAGGCGCAGGTCTCAAGGCGG - Intronic
1059483792 9:114611780-114611802 CCCAACCGCGGGCCCCCAGGAGG - Intronic
1060849154 9:126860583-126860605 CGGAAGCGCGGGCGTCCAGGGGG + Intergenic
1061406615 9:130395905-130395927 CCCTGGCGGGGCTCTCCAGGAGG + Intronic
1188060023 X:25590175-25590197 CCCAACCTCAGGCCTCCAGGAGG + Intergenic
1190829038 X:54044135-54044157 CCCAAGCCGCGGTCTCCAGTAGG - Intronic
1195536537 X:106014270-106014292 CCCAACCTCAGGCCTCCAGGAGG + Intergenic
1196961219 X:121004337-121004359 CCAAAGCCAGGGTCTCCAAGGGG + Intergenic
1198317244 X:135480403-135480425 CCCAAAAGAGGGTCTCCAAGAGG - Intergenic