ID: 941908164 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:170737049-170737071 |
| Sequence | CTGAATATACATACAGACAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941908159_941908164 | 23 | Left | 941908159 | 2:170737003-170737025 | CCAGCTTTCACCAACAAACTTCT | No data | ||
| Right | 941908164 | 2:170737049-170737071 | CTGAATATACATACAGACAATGG | No data | ||||
| 941908161_941908164 | 13 | Left | 941908161 | 2:170737013-170737035 | CCAACAAACTTCTCAAGGCCATT | No data | ||
| Right | 941908164 | 2:170737049-170737071 | CTGAATATACATACAGACAATGG | No data | ||||
| 941908162_941908164 | -5 | Left | 941908162 | 2:170737031-170737053 | CCATTTAAGCCTGAAAGACTGAA | No data | ||
| Right | 941908164 | 2:170737049-170737071 | CTGAATATACATACAGACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941908164 | Original CRISPR | CTGAATATACATACAGACAA TGG | Intergenic | ||
| No off target data available for this crispr | |||||