ID: 941908164

View in Genome Browser
Species Human (GRCh38)
Location 2:170737049-170737071
Sequence CTGAATATACATACAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941908159_941908164 23 Left 941908159 2:170737003-170737025 CCAGCTTTCACCAACAAACTTCT No data
Right 941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG No data
941908161_941908164 13 Left 941908161 2:170737013-170737035 CCAACAAACTTCTCAAGGCCATT No data
Right 941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG No data
941908162_941908164 -5 Left 941908162 2:170737031-170737053 CCATTTAAGCCTGAAAGACTGAA No data
Right 941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941908164 Original CRISPR CTGAATATACATACAGACAA TGG Intergenic
No off target data available for this crispr