ID: 941915922

View in Genome Browser
Species Human (GRCh38)
Location 2:170813916-170813938
Sequence GCTCAAAGGCAGAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941915922_941915929 27 Left 941915922 2:170813916-170813938 CCCTCCTTCTTCTGCCTTTGAGC No data
Right 941915929 2:170813966-170813988 TCAAATACAATCGAAACAGCTGG No data
941915922_941915930 28 Left 941915922 2:170813916-170813938 CCCTCCTTCTTCTGCCTTTGAGC No data
Right 941915930 2:170813967-170813989 CAAATACAATCGAAACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941915922 Original CRISPR GCTCAAAGGCAGAAGAAGGA GGG (reversed) Intronic
No off target data available for this crispr