ID: 941917126

View in Genome Browser
Species Human (GRCh38)
Location 2:170820226-170820248
Sequence GGCCACCGGGAATTCCGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941917126_941917134 9 Left 941917126 2:170820226-170820248 CCCTTACGGAATTCCCGGTGGCC No data
Right 941917134 2:170820258-170820280 CGGCGCAAATGCCAAGTCACCGG No data
941917126_941917137 27 Left 941917126 2:170820226-170820248 CCCTTACGGAATTCCCGGTGGCC No data
Right 941917137 2:170820276-170820298 ACCGGTAGGAGACACAACAGAGG No data
941917126_941917135 13 Left 941917126 2:170820226-170820248 CCCTTACGGAATTCCCGGTGGCC No data
Right 941917135 2:170820262-170820284 GCAAATGCCAAGTCACCGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941917126 Original CRISPR GGCCACCGGGAATTCCGTAA GGG (reversed) Intronic
No off target data available for this crispr