ID: 941918779

View in Genome Browser
Species Human (GRCh38)
Location 2:170829074-170829096
Sequence CTGTATAAGCAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 381}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941918779_941918783 -6 Left 941918779 2:170829074-170829096 CCCTCCTCCTTCTGCTTATACAG 0: 1
1: 0
2: 2
3: 45
4: 381
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941918779 Original CRISPR CTGTATAAGCAGAAGGAGGA GGG (reversed) Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
907229760 1:52985319-52985341 CAGTTTAAGCAACAGGAGGATGG - Intronic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
909316338 1:74223981-74224003 CTCTATAATCAGCAGGAGGAGGG - Intronic
909622698 1:77685047-77685069 CTCTATAAGTAGAAAGAGCAAGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
922135733 1:222824421-222824443 GTGTATAAGCAAAAGCAGAAGGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG + Intronic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072022004 10:91411010-91411032 CTGTTTAATCTGAAGGGGGAAGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG + Intergenic
1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG + Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1089312690 11:117570336-117570358 CTGTCTAAGGAGAAGCAGAACGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG + Intergenic
1099043737 12:77689035-77689057 CTGCATAAGCAGAAGGGTTAAGG + Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100378852 12:94043228-94043250 CTTTATTAGCAGAATGAGAATGG - Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1102397620 12:112600803-112600825 CTTTATTAGCAGCATGAGGACGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1104190286 12:126475607-126475629 CTTTATTAGCAGAATGAGAATGG - Intergenic
1105212219 13:18263674-18263696 CTGTCTAACCACAAGGTGGAAGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114578142 14:23731662-23731684 CTTTATGAGCAGAAGAAAGAAGG - Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1119090264 14:71774259-71774281 CTGCATGAGCACTAGGAGGATGG + Intergenic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124357445 15:29006488-29006510 CTGTATTAGCAGCATGAGAATGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG + Intergenic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG + Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1142907361 17:3053133-3053155 CTCTCTAAGCAAAGGGAGGAGGG - Intergenic
1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG + Intergenic
1144463421 17:15477438-15477460 CTATTACAGCAGAAGGAGGAAGG - Intronic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152826530 17:82469473-82469495 CTCTATAAGCAAATGGAGGGAGG - Intronic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG + Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1159178982 18:64876890-64876912 CTTTATTAGCAGAATGAGAATGG - Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160361729 18:78288641-78288663 ATGTATAACCAGAAGTGGGATGG - Intergenic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG + Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162127691 19:8508146-8508168 CTGTATATCCAGGAGGATGAGGG + Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926415555 2:12646234-12646256 CTTTATAAGCAGCATGAGAATGG - Intergenic
927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG + Intergenic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930203397 2:48565346-48565368 CTGTATAAGAAGTCGGAGGCTGG - Intronic
930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG + Intergenic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
934601945 2:95664336-95664358 CTATAAAAGCAGAAGTCGGATGG + Intergenic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG + Intergenic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
946027328 2:216679690-216679712 CTTCATAAGCGGCAGGAGGAGGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173924435 20:46770342-46770364 CTTTATTAGCAGCATGAGGATGG - Intergenic
1174139909 20:48405629-48405651 GTGTATGAGCTCAAGGAGGAAGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177241307 21:18461719-18461741 CTATATAATTAAAAGGAGGATGG - Intronic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178331449 21:31697630-31697652 GTCTATAAGCAGAATGAGCACGG - Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949824522 3:8151500-8151522 GTATATAACAAGAAGGAGGAAGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951763638 3:26172425-26172447 CTGTATAAGCAGCATGAAAATGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
965013160 3:163123532-163123554 CTACATAAGCAGAAGGAAAAGGG - Intergenic
965425584 3:168518653-168518675 CTTTATTAGCAGAATGAGAATGG - Intergenic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972199203 4:36693086-36693108 CTCTCTTACCAGAAGGAGGAGGG - Intergenic
972422286 4:38899986-38900008 CTATCTAAGCAGAAAGAGGCTGG + Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
975079998 4:70265679-70265701 GTGTATACCCAGAAGTAGGATGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG + Intergenic
984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
989563904 5:42881958-42881980 TTCTATTAGCAGAAGAAGGAGGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991608300 5:68425120-68425142 TTATATAATCAGAAGTAGGAAGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG + Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG + Intergenic
999846614 5:155488388-155488410 CTGTATAATCACATGGTGGAAGG - Intergenic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG + Intergenic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1014330826 6:120061412-120061434 CTGTATTAGCAGCATGAGAATGG - Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016124035 6:140376654-140376676 CTTTATAAGCCAAAGAAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016682454 6:146846106-146846128 CTGTATTAGCAGCATGAGAATGG - Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017395123 6:153990006-153990028 CTATATAGGCAGAAGGTTGAAGG - Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG + Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023570816 7:41569617-41569639 CTCTAGAAGCAGAAGCAAGAAGG + Intergenic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1039503948 8:38038092-38038114 CTGTATGAGGATAAGTAGGAGGG - Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG + Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG + Intergenic
1186057965 X:5671602-5671624 CTTTATTAGCAGAATGAGAATGG - Intergenic
1186567075 X:10674632-10674654 CTTTATAACCAGAATGAGCATGG + Intronic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188054689 X:25527528-25527550 CTTTATTAGCAGAATGAGAACGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG + Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1197995349 X:132366877-132366899 CTTTATTAGCAGCATGAGGATGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201589879 Y:15603391-15603413 CTTTATTAGCAGAATGAGAATGG - Intergenic