ID: 941918783

View in Genome Browser
Species Human (GRCh38)
Location 2:170829091-170829113
Sequence ATACAGCCCATAAACAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 126}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941918775_941918783 17 Left 941918775 2:170829051-170829073 CCTCCTACCTCTGCTGTTCTCTC 0: 1
1: 0
2: 8
3: 69
4: 626
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126
941918779_941918783 -6 Left 941918779 2:170829074-170829096 CCCTCCTCCTTCTGCTTATACAG 0: 1
1: 0
2: 2
3: 45
4: 381
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126
941918780_941918783 -7 Left 941918780 2:170829075-170829097 CCTCCTCCTTCTGCTTATACAGC 0: 1
1: 0
2: 1
3: 25
4: 343
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126
941918778_941918783 -5 Left 941918778 2:170829073-170829095 CCCCTCCTCCTTCTGCTTATACA 0: 1
1: 0
2: 4
3: 37
4: 474
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126
941918777_941918783 10 Left 941918777 2:170829058-170829080 CCTCTGCTGTTCTCTCCCCTCCT 0: 1
1: 0
2: 22
3: 235
4: 2413
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126
941918776_941918783 14 Left 941918776 2:170829054-170829076 CCTACCTCTGCTGTTCTCTCCCC 0: 1
1: 1
2: 3
3: 83
4: 712
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126
941918773_941918783 27 Left 941918773 2:170829041-170829063 CCTCACCTCTCCTCCTACCTCTG 0: 1
1: 2
2: 11
3: 104
4: 1081
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126
941918781_941918783 -10 Left 941918781 2:170829078-170829100 CCTCCTTCTGCTTATACAGCCCA 0: 1
1: 0
2: 1
3: 22
4: 242
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126
941918774_941918783 22 Left 941918774 2:170829046-170829068 CCTCTCCTCCTACCTCTGCTGTT 0: 1
1: 0
2: 7
3: 79
4: 645
Right 941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941918783 Original CRISPR ATACAGCCCATAAACAGTGC TGG Intronic
905290047 1:36915153-36915175 ATACAGCAGATAAACAGTAGGGG + Intronic
905527828 1:38652552-38652574 ATACAGCCCATACTAAGTGTTGG - Intergenic
906478232 1:46184151-46184173 AGGCAGGCCTTAAACAGTGCTGG - Intronic
908690109 1:66769997-66770019 ATAAAGCTCACAAACAGGGCTGG - Intronic
910451430 1:87350214-87350236 ATAAAGCACATCATCAGTGCAGG - Intergenic
915823455 1:159050704-159050726 CTACAACTCAGAAACAGTGCAGG + Intronic
917093779 1:171380306-171380328 AGACAGACAATAAAAAGTGCTGG - Intergenic
920397761 1:205659358-205659380 ATGGAGCCCATAAACAGGGATGG + Exonic
920423431 1:205852444-205852466 ATAAATCCCACAAACAGTGTTGG - Intergenic
921357307 1:214297572-214297594 ATACTGCACATACACAGTGCAGG + Intronic
1063716667 10:8534288-8534310 ATAAAGCCCATAAACTATGAAGG + Intergenic
1065992367 10:31024757-31024779 AAACAGCCCATAAAATGTGTAGG - Intronic
1069562441 10:69440256-69440278 ATACAGCCCATAAATAGAAGAGG + Intergenic
1071534083 10:86413329-86413351 ATACAGCGCATGTTCAGTGCAGG + Intergenic
1072444072 10:95482730-95482752 ATACTGCACATACTCAGTGCTGG - Intronic
1073660491 10:105470746-105470768 ATACAGCCCATAGATATTTCAGG + Intergenic
1074877422 10:117624867-117624889 AGACAGCCCATATATACTGCAGG - Intergenic
1079506868 11:21162729-21162751 ATACAGAGAATAAACAGAGCCGG + Intronic
1079611954 11:22444163-22444185 ATACAACTCATAAAAAGTGATGG - Intergenic
1085425308 11:76399435-76399457 AGACAGCAAATAAACAGTTCAGG - Intronic
1085663812 11:78394707-78394729 ATACAGTCCATAGAAATTGCTGG + Intronic
1087586990 11:100134354-100134376 ATACAGCCAATAAAATGTGGAGG - Intronic
1089280323 11:117369744-117369766 ATACAGCCAATAATCTCTGCTGG - Intronic
1090335750 11:125962805-125962827 TTTCAGCCGATAAACAGAGCCGG - Intronic
1093389920 12:18605883-18605905 ATAGAGACAATAAACGGTGCAGG - Intronic
1097276752 12:57818964-57818986 ACACAGCCCATCAATAATGCAGG + Intergenic
1100697187 12:97107741-97107763 ATACACCCCAAATACTGTGCTGG - Intergenic
1104318775 12:127730050-127730072 AGACAGCCCATAACAAATGCTGG + Intergenic
1105655903 13:22438431-22438453 ATACAGCTAACAAACAGTACAGG - Intergenic
1107140952 13:36998607-36998629 ATACTGCCCCTAAACAAGGCAGG - Intronic
1108156740 13:47592688-47592710 ATACAGGCCATAAACCTTGATGG - Intergenic
1108282113 13:48870927-48870949 AAACAGGCCATAAACTGGGCTGG + Intergenic
1109569584 13:64169506-64169528 ACACAGCCTATAAAGAGTACAGG - Intergenic
1110418161 13:75274741-75274763 ATATAGACCATAAATAGTGTGGG + Intergenic
1111298586 13:86316820-86316842 ATACAGCCCCTGCAAAGTGCTGG + Intergenic
1116869498 14:50057703-50057725 GTAAACCCCATGAACAGTGCTGG - Intergenic
1120987235 14:90345134-90345156 AGAAAGCAGATAAACAGTGCTGG + Intergenic
1124837413 15:33208649-33208671 ACACAGACCATAACCAGTTCTGG - Intergenic
1130559734 15:84948538-84948560 ATAAAACCCAGAAACAGAGCTGG + Intergenic
1130749696 15:86697916-86697938 AGACAGCCCAAATACTGTGCTGG - Intronic
1131552861 15:93372970-93372992 AAACAGCCCACAAACAGGGAAGG - Intergenic
1132779163 16:1613550-1613572 CTGCAGCCCAGAAACAGTCCGGG - Intronic
1136765073 16:32769909-32769931 AGACAGCCCACAAACTGTCCAGG + Intergenic
1136803026 16:33100475-33100497 AGACAGCCCACAAACTGTCCAGG - Intergenic
1137551729 16:49441882-49441904 ATTTACCCCATAAACAGTGTGGG + Intergenic
1138828001 16:60344223-60344245 ATATTGTCCATAAACAGTGTTGG + Intergenic
1139314562 16:66057296-66057318 ACACAGCCCAAGAGCAGTGCTGG + Intergenic
1139637170 16:68264684-68264706 ATGCGGCCCAGAAACAGCGCGGG + Intronic
1143343114 17:6229446-6229468 ATACAGACCAACACCAGTGCTGG + Intergenic
1146320526 17:31843136-31843158 GTCCTGCCCATAAACAATGCAGG + Intergenic
1148472861 17:47906346-47906368 ATACAGCCCATAGGCACTGAAGG + Intronic
1149812771 17:59693516-59693538 AAAAAGCCAACAAACAGTGCAGG - Intronic
1150751932 17:67872120-67872142 AAACAGACCAAAAACAGGGCTGG - Intronic
1151289393 17:73138594-73138616 ATAACACCCATACACAGTGCTGG + Intergenic
1153052347 18:910812-910834 AAACAGTACTTAAACAGTGCAGG - Exonic
1153745754 18:8177905-8177927 ATACAGCCCCTCCCCAGTGCTGG - Intronic
1154391523 18:13940710-13940732 AAGCAGCCAATAAACAGAGCAGG + Intergenic
1155858393 18:30864671-30864693 TTACAGCCAATAAAAAGTGGAGG - Intergenic
1155968685 18:32060289-32060311 TTACAGCCCATTCACTGTGCAGG - Intronic
1158348770 18:56542823-56542845 ATACATTTTATAAACAGTGCAGG - Intergenic
1158728417 18:59996121-59996143 GTAGAGCCCAGAAACAGTGAGGG - Intergenic
1163081260 19:14944275-14944297 ATAAAGCTCTTAAACTGTGCTGG - Intergenic
1164004123 19:21133532-21133554 TTACAGCCCCTAAACCGTGAAGG - Intergenic
1166262805 19:41653179-41653201 AGACAGCCCAAATACTGTGCTGG + Intronic
925652640 2:6107650-6107672 AAATAGCCCATGAACAGTGCCGG - Intergenic
932969432 2:76521904-76521926 AAACAGTCCACAAACTGTGCAGG - Intergenic
938217209 2:129528712-129528734 AGACAGGCAATAAAAAGTGCTGG + Intergenic
941918783 2:170829091-170829113 ATACAGCCCATAAACAGTGCTGG + Intronic
942206081 2:173620975-173620997 ATACAGGCCATCTTCAGTGCCGG + Intergenic
946621301 2:221566648-221566670 ATCCAGCCCATTAAAAGTACTGG + Intronic
947792179 2:232874796-232874818 GTGCTGCCCAGAAACAGTGCAGG - Intronic
1172579539 20:36036028-36036050 ACACAGCCCTGAAACTGTGCTGG + Intergenic
1173930939 20:46817899-46817921 AAAGAGCCCATACACAGTGTTGG + Intergenic
1175494793 20:59406314-59406336 TTCCAGCACATAAACATTGCAGG - Intergenic
1175501154 20:59452105-59452127 ATAGAGCCAATAAATAGTGGAGG - Intergenic
1177893700 21:26837075-26837097 ATAGCAGCCATAAACAGTGCTGG + Exonic
1178257075 21:31063844-31063866 TAACAGCCAATGAACAGTGCAGG + Intergenic
1179532092 21:42026742-42026764 TTACAGCCCATACACCCTGCAGG + Intergenic
1179532328 21:42028496-42028518 TTACAGCCCATACACCCTGCAGG + Intergenic
950315461 3:11998135-11998157 ATCCACCCCAGAGACAGTGCTGG - Intergenic
954891819 3:53937509-53937531 ATAAAGCCCCTAAACAATGGGGG + Intergenic
956223896 3:66934447-66934469 ATACAACACATATGCAGTGCAGG - Intergenic
960715333 3:120569444-120569466 GCATAGCCCATACACAGTGCAGG + Intergenic
962991965 3:140585935-140585957 AGCCAGCTCATTAACAGTGCTGG - Intergenic
964120456 3:153177941-153177963 AAACACCCCAAATACAGTGCTGG - Intergenic
968387668 4:156273-156295 ATACAACTTATAAACAATGCAGG - Intronic
969248024 4:5948178-5948200 ATACAGCACATAAGCTTTGCAGG + Intronic
970111664 4:12644658-12644680 ATCCTGCCCATTAACAGTGAGGG - Intergenic
970601543 4:17644143-17644165 ATACAGGTCATAATCAGTGGTGG + Intronic
971828669 4:31661778-31661800 GTAAAGCCTATACACAGTGCAGG - Intergenic
974582930 4:63829804-63829826 ATACTGCCAATAAACACAGCTGG + Intergenic
977185995 4:93937184-93937206 AGACAGGCAATAACCAGTGCTGG + Intergenic
979080999 4:116341064-116341086 AAACAGCCCAAACACAGTCCTGG + Intergenic
990696729 5:58426496-58426518 CTACAGGCCATAAGCAGTGAGGG + Intergenic
992906557 5:81352093-81352115 AGACAGGCAATAACCAGTGCTGG + Intronic
993356384 5:86913925-86913947 ATACAGGCAATAAAAAATGCTGG + Intergenic
1000530016 5:162408047-162408069 ATACAGCCCAAGAAGTGTGCAGG - Intergenic
1007220198 6:40272803-40272825 ACAGAGCCCCAAAACAGTGCAGG + Intergenic
1009752140 6:67887571-67887593 AGACAGGCCATAAACTGAGCTGG + Intergenic
1010666699 6:78639296-78639318 TTACGGCTCATAAACAGGGCAGG - Intergenic
1015025283 6:128525104-128525126 ATAAAGCCCATGAATAGAGCAGG + Intergenic
1016868208 6:148790540-148790562 CTACAGCACCTTAACAGTGCAGG - Intronic
1023226778 7:37978176-37978198 ATACGGGCCTTAAAAAGTGCTGG + Intronic
1026569164 7:71514386-71514408 ATTGAGCTCATAAACAGTGGGGG + Intronic
1030544926 7:110881351-110881373 ATGGTTCCCATAAACAGTGCTGG - Intronic
1030826272 7:114162435-114162457 AAACAGACCAGAAACAGTACAGG - Intronic
1031040741 7:116836188-116836210 AGCCAGCCTACAAACAGTGCTGG - Intronic
1035199155 7:157248960-157248982 ACACACCCCCTAGACAGTGCTGG - Intronic
1036214996 8:6871873-6871895 AAACTGCCCATAAACAGACCAGG - Intronic
1036437822 8:8751291-8751313 AGACCGCCCATAAATTGTGCTGG + Intergenic
1038589379 8:28822514-28822536 ATCTGGCCCAAAAACAGTGCTGG + Intronic
1039448461 8:37651231-37651253 TTGCAGCCCAGAAACAGAGCAGG - Intergenic
1040841615 8:51791107-51791129 ACACAGCTCATAAACTGTGAAGG + Intronic
1047858241 8:128936213-128936235 TTAAAGCCCTTAAACAGTGGTGG + Intergenic
1049116386 8:140691909-140691931 ACACAGCTCTTAAACAGTGGAGG + Intronic
1054847157 9:69809548-69809570 AAACAGCCCTAAAACAGAGCAGG + Intergenic
1055322228 9:75093929-75093951 AGACAGAGCATACACAGTGCTGG - Intronic
1055892443 9:81137826-81137848 ATACATCCCATACCCTGTGCTGG + Intergenic
1058775143 9:108275904-108275926 AAACAGCCCATCAACTGTTCTGG + Intergenic
1060604056 9:124898603-124898625 ATGCAGCCCTTAAAGAATGCAGG - Exonic
1062265338 9:135684268-135684290 ATTCAGCCCAGGAACTGTGCTGG - Intergenic
1186028037 X:5335488-5335510 CTACAGCCAATAAACAGATCAGG + Intergenic
1188203291 X:27319536-27319558 ATACAGACCACAAAAAGTTCTGG + Intergenic
1190960514 X:55241985-55242007 ATACAGCATATAAACAGAACCGG + Intronic
1193590801 X:83386534-83386556 AGACAGCCCAAATACTGTGCTGG + Intergenic
1197402867 X:126013491-126013513 AGACAGGCAATTAACAGTGCTGG - Intergenic
1199205998 X:145148879-145148901 AGACAGCCCAAATACTGTGCTGG + Intergenic
1200335341 X:155345247-155345269 ATACATTCAATAAACGGTGCTGG - Intergenic
1200351127 X:155495974-155495996 ATACATTCAATAAACGGTGCTGG + Intronic