ID: 941919024

View in Genome Browser
Species Human (GRCh38)
Location 2:170830754-170830776
Sequence AGTTTTGCACATGCTTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941919024_941919027 0 Left 941919024 2:170830754-170830776 CCCCAGGAAGCATGTGCAAAACT 0: 1
1: 0
2: 0
3: 8
4: 205
Right 941919027 2:170830777-170830799 TCTGTGTATGTGCATTTTTCTGG 0: 1
1: 2
2: 20
3: 97
4: 630
941919024_941919028 8 Left 941919024 2:170830754-170830776 CCCCAGGAAGCATGTGCAAAACT 0: 1
1: 0
2: 0
3: 8
4: 205
Right 941919028 2:170830785-170830807 TGTGCATTTTTCTGGAGATGTGG 0: 1
1: 2
2: 12
3: 243
4: 2705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941919024 Original CRISPR AGTTTTGCACATGCTTCCTG GGG (reversed) Intronic
900923847 1:5690844-5690866 GGGTTTACACAAGCTTCCTGAGG - Intergenic
901632615 1:10655324-10655346 AGCATTGCAAATGATTCCTGAGG - Intronic
903021855 1:20400402-20400424 AGCTTTGCTCAAGCTGCCTGGGG + Intergenic
903580241 1:24365314-24365336 AGTGTTGCACCTCCTTGCTGGGG + Intronic
905222081 1:36455055-36455077 GCTTTTGCATATGCTTCCTGGGG + Intergenic
905706511 1:40063848-40063870 AATTTTCCTCATGCTTCATGAGG - Intronic
907481731 1:54749607-54749629 TGTGTTCCACATGCTTCATGCGG - Intergenic
908544951 1:65153243-65153265 ATCTTTGCACATTCTTCCAGTGG + Intronic
911958298 1:104265340-104265362 AGTGATGTACATGATTCCTGGGG + Intergenic
912207472 1:107524316-107524338 GGTTTTGCACACACATCCTGAGG - Intergenic
913065810 1:115253521-115253543 AGTCTTGTTCATGTTTCCTGGGG - Intergenic
914462354 1:147897115-147897137 AGTTCTGGAGATGCTTCCTCTGG + Intergenic
917535195 1:175869415-175869437 AATTCTGCACATGCCTCATGCGG + Intergenic
919476558 1:198037937-198037959 TGTTTTGCCCATCCATCCTGTGG + Intergenic
921102133 1:211937561-211937583 AGTTTTGCTCTTGTTGCCTGGGG - Intergenic
923965518 1:239134515-239134537 AGTTTTACGCATGCTCACTGGGG - Intergenic
1064476497 10:15695797-15695819 TGATGTCCACATGCTTCCTGAGG - Intronic
1064515019 10:16138101-16138123 AGTTTTTCAAATTCTTCTTGAGG + Intergenic
1064547488 10:16465354-16465376 AATGTTGCAAATGTTTCCTGAGG - Intronic
1067715424 10:48686825-48686847 ATTTTTGTACATGCATCTTGGGG + Intronic
1071106999 10:82109810-82109832 AGTTCTGCACCTGCTGCATGGGG - Intronic
1071615000 10:87067141-87067163 AATTTTGCTGATCCTTCCTGGGG - Intronic
1072584979 10:96773566-96773588 AGTTTTGCTCTTGTTGCCTGGGG - Intergenic
1073270375 10:102257981-102258003 AGAATTTGACATGCTTCCTGAGG + Intronic
1073820864 10:107262798-107262820 AGTGTTGTCCATGATTCCTGGGG + Intergenic
1073977131 10:109114912-109114934 AGAATTGCAAATGCTTCCTTTGG - Intergenic
1074101379 10:110357213-110357235 AGTGCTGGAAATGCTTCCTGTGG + Intergenic
1076745919 10:132513953-132513975 AGTTTTTCTCATGCTTCTTGAGG + Intergenic
1078717952 11:13857648-13857670 ACGTTTGCCCATGCTGCCTGAGG - Intergenic
1080831868 11:35902041-35902063 AGCTTTGCACATTGTTACTGAGG - Intergenic
1081582241 11:44360293-44360315 CCTTTTGCAAAAGCTTCCTGAGG - Intergenic
1083014869 11:59443158-59443180 GGTTATGGACATGCTTCCCGTGG - Exonic
1085659180 11:78347239-78347261 AGTTTCCAACATGCTTGCTGTGG + Intronic
1086044932 11:82521572-82521594 AGTTGTGCACATGATTCCCTGGG + Intergenic
1086485975 11:87302339-87302361 ACTTTTGCATATGCTGCCTCTGG - Exonic
1086873658 11:92069933-92069955 AATTTTCCACATGCTTGGTGTGG - Intergenic
1088281770 11:108142280-108142302 AGCTGTGTACATGTTTCCTGAGG + Intronic
1088905571 11:114153180-114153202 ACTTTTCCACATTCTTCCTTTGG + Intronic
1089759057 11:120709487-120709509 AGTTTTGGAGTTACTTCCTGAGG + Intronic
1090630636 11:128644251-128644273 CATTTTCCACATGCTTCATGTGG + Intergenic
1090941180 11:131389538-131389560 AGTTTTACACGTTCTTCCCGAGG - Intronic
1091580722 12:1787070-1787092 AGTTTTCCATATCCTTGCTGTGG + Exonic
1092179237 12:6434048-6434070 ATTTTTGCATATGTCTCCTGGGG + Intergenic
1093431833 12:19093493-19093515 ATTTCTGCACATGCTTTCTTTGG + Intergenic
1093916807 12:24812027-24812049 AATTCTGCAAATGTTTCCTGGGG - Intronic
1098133184 12:67372978-67373000 AGTTTTGCCCTTGTTTTCTGAGG + Intergenic
1098625293 12:72658853-72658875 AGTTTAACAGATGCTGCCTGAGG + Intronic
1098922711 12:76317026-76317048 AGTTTTGCATAAGCTTCCATAGG - Intergenic
1108614423 13:52117524-52117546 AGTTCTGCAAAAGCTTCCAGTGG + Intronic
1111699873 13:91673173-91673195 GGTTCTGCACATGTATCCTGTGG + Intronic
1113012104 13:105779982-105780004 AATTATGGACATGCTCCCTGTGG + Intergenic
1113068883 13:106399134-106399156 ATTGTTGCTCATACTTCCTGGGG - Intergenic
1115527690 14:34298029-34298051 AGTTATGCACATGCTCTCTTAGG - Intronic
1121009546 14:90512071-90512093 TGTTGTCCCCATGCTTCCTGGGG + Intergenic
1121797785 14:96749855-96749877 AGTTTGGGAAATGCTGCCTGAGG + Intergenic
1121876843 14:97460605-97460627 ATTTTTGCAAATACTTCCAGAGG + Intergenic
1122197439 14:100099443-100099465 TGTTTTGAACATGCTTCCCATGG + Intronic
1123969275 15:25490354-25490376 TGTTTTCCACATGCTTTATGTGG - Intergenic
1124219947 15:27842754-27842776 AGTCTTGCCCAAGCTTTCTGAGG + Intronic
1126954231 15:53914476-53914498 ATATTTGCAGATGCTCCCTGGGG + Intergenic
1131566489 15:93490503-93490525 AGTTTTGCTGTTTCTTCCTGTGG + Intergenic
1133456337 16:5945700-5945722 AGGTTTGCAGATTCTACCTGAGG - Intergenic
1135546476 16:23370444-23370466 AGTTGAGCACTTGCTACCTGCGG - Intronic
1135649248 16:24191295-24191317 TGTTTTCCAAATGCTCCCTGAGG + Intronic
1138261766 16:55628751-55628773 AGTTGTGCACATGCTCACTTGGG - Intergenic
1138953790 16:61946291-61946313 AGTCTTGCTCAAACTTCCTGTGG - Intronic
1143130774 17:4675597-4675619 AGTGTAGCAAATGCTTCCTTGGG - Intronic
1143265867 17:5636981-5637003 AAATGTGCACATGCTTCCTGCGG - Intergenic
1146230031 17:31099092-31099114 AGACATGCACATGCTCCCTGGGG - Intronic
1149219052 17:54393709-54393731 AGTTTTGTACATTATTCCTTAGG - Intergenic
1151175787 17:72287033-72287055 AGTTTTACAGGTGATTCCTGGGG + Intergenic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1153275509 18:3363482-3363504 AGTTTGTCAGAAGCTTCCTGCGG - Intergenic
1157527603 18:48396606-48396628 ACGTTTGCATATGCTTCCTTCGG - Intronic
1158516925 18:58138402-58138424 ACCTGTGCACATGCTTCATGAGG - Intronic
1158552325 18:58446524-58446546 AGTTTTCCTCAAGCTTTCTGAGG - Intergenic
1159990846 18:74905354-74905376 AGATGTGCACAGGTTTCCTGCGG + Intronic
1162792682 19:13071167-13071189 AGCTCTGCACATGGGTCCTGAGG + Intronic
1163426953 19:17245353-17245375 AGTTTTGCAGCAACTTCCTGCGG + Exonic
1163870131 19:19814379-19814401 AGTTTTGCACTTGCTGCCCAGGG - Intronic
1166320550 19:42015926-42015948 AGCTTTGCACATGTGTTCTGTGG - Intronic
1166643214 19:44512158-44512180 ATTTCTGCACTTCCTTCCTGGGG - Intronic
925350980 2:3200613-3200635 AGTTCTGGACAGGCTTCCCGAGG - Intronic
926899202 2:17730948-17730970 AGTTACACATATGCTTCCTGTGG + Intronic
928006961 2:27571203-27571225 AGTTTTACACCTCCTGCCTGTGG - Intergenic
928333272 2:30374155-30374177 AGTTTTGGACAGGCTGCCAGGGG - Intergenic
928615797 2:33038398-33038420 AGGTTTTAACATGCTTCATGGGG - Intronic
929570958 2:43022549-43022571 AGTTCTGCTCATTCTTCCTCAGG + Intergenic
932096090 2:68850112-68850134 ACTTTTTCGAATGCTTCCTGTGG + Intergenic
932108582 2:68972145-68972167 AGTCTTGCTCATGCTTCATTAGG + Intergenic
933184340 2:79261876-79261898 AGTTTTTCACATACTGCCTCTGG + Intronic
933781490 2:85804950-85804972 ACTTTTGCATATCTTTCCTGAGG + Intergenic
936451884 2:112639999-112640021 AGTTTAGCACATGGGACCTGGGG - Intergenic
939124693 2:138164125-138164147 AGTTTTGCACATTATTGATGAGG + Intergenic
940052438 2:149478793-149478815 ATTTTTCCACCTGCTACCTGGGG + Intergenic
940733407 2:157420487-157420509 AGTTTTGCTCTTGTTGCCTGGGG - Intronic
940767567 2:157806632-157806654 AGTTTGGCACAAGCTGCCTTTGG - Intronic
941919024 2:170830754-170830776 AGTTTTGCACATGCTTCCTGGGG - Intronic
944198763 2:197083338-197083360 AGCCTTGCTCATGCTTCCTCTGG - Intronic
944331201 2:198468428-198468450 AGTTCTGCAGATGCCTTCTGTGG - Intronic
944426009 2:199583948-199583970 CGTTTTGCAAATGCCTCCTGTGG + Intergenic
945261233 2:207845081-207845103 AGTTGTGAAGATGTTTCCTGAGG + Intronic
946762457 2:223008215-223008237 ATTTTTTCTCATGCATCCTGGGG + Intergenic
1170045345 20:12079589-12079611 ATTTCTGCACATGCGTCCTTTGG - Intergenic
1174339096 20:49884828-49884850 AGCTTTGCACAGGGGTCCTGAGG - Intronic
1174841304 20:53903946-53903968 CCTATTGCACTTGCTTCCTGAGG - Intergenic
1174931262 20:54817769-54817791 AATCTTGCCCATGCCTCCTGAGG - Intergenic
1175446792 20:59026430-59026452 GGATTTACACATGCTTCCTCTGG + Exonic
1177662658 21:24106275-24106297 AGCTTTTCACATGTTTACTGAGG - Intergenic
1177755289 21:25339446-25339468 AGTTCTGCAAATATTTCCTGGGG - Intergenic
1178681438 21:34675660-34675682 AGGTGTGCACATGCATGCTGGGG + Intronic
1179451787 21:41473186-41473208 AGTATTGCACCTGCTTCCTAGGG - Intronic
1179563298 21:42230831-42230853 GGATCTGCACATTCTTCCTGTGG + Intronic
1180851077 22:19021182-19021204 ATTTTTGCACCTGCCTCTTGGGG - Intergenic
1181634385 22:24167735-24167757 AGTTTTGGAGATTCTTCCTATGG - Intronic
1184372216 22:44089809-44089831 AGCTTTGGACATGCTGGCTGTGG + Intronic
1184573020 22:45338853-45338875 ACTATTGCACATGGTCCCTGTGG - Intronic
1184755871 22:46515395-46515417 AGGTTTGCACATGTTTCATCAGG + Intronic
1185356235 22:50373015-50373037 AGTTTTGCACATATTTAATGAGG + Intronic
949610646 3:5699888-5699910 AATTTTGCTCAGGGTTCCTGAGG + Intergenic
955860931 3:63329622-63329644 ATTTTTACACCTGCATCCTGAGG + Intronic
956575958 3:70753061-70753083 AGTTTTCCATTTGCTTACTGGGG + Intergenic
957638181 3:82814757-82814779 AGTTTTGCTCAGGCCTGCTGGGG + Intergenic
958701189 3:97592639-97592661 CGTTTTGCCCCAGCTTCCTGAGG + Exonic
959256924 3:104027226-104027248 AGTTGTGCACATCGTTACTGGGG + Intergenic
961085997 3:124067941-124067963 TGTACTGCACATGTTTCCTGAGG + Intergenic
964103667 3:153017474-153017496 AGTATTGAACATGCATGCTGTGG + Intergenic
965529970 3:169761684-169761706 AGATGTCCACATGGTTCCTGAGG - Intergenic
968028396 3:195462336-195462358 TGCTTTGCAAATGCTTCCTTAGG + Intergenic
968237482 3:197043358-197043380 AGGTTTTCAAATGGTTCCTGAGG - Exonic
969091869 4:4700396-4700418 AATTTTGCATATGCTTCTTCTGG + Intergenic
969836485 4:9846462-9846484 GGTATAGCAGATGCTTCCTGGGG + Intronic
973869753 4:55154353-55154375 AGTTTGGCACTTGCTCCCTTTGG - Intergenic
973904367 4:55512343-55512365 ATCTTTTCACATGCTTCTTGAGG + Intronic
973966235 4:56164793-56164815 AGTTTTGATCAGGCTTACTGAGG - Intergenic
976263742 4:83171031-83171053 AGTTATGCACATGCTCTCTTAGG + Intergenic
976327098 4:83784127-83784149 TGTTTTTCACATACTTTCTGTGG - Intergenic
976553970 4:86429191-86429213 AGGTTTCCACATGCTTCCAGGGG + Intronic
978752936 4:112272485-112272507 AGTTATGCACATGCTCTCTTAGG - Intergenic
980651905 4:135727451-135727473 TGTATTGCACATATTTCCTGAGG + Intergenic
980966654 4:139527933-139527955 ACTTTTGGACAAGCTTCCTTTGG + Intronic
983741993 4:171146878-171146900 AGTTTTGCACCTGCTTCTATTGG - Intergenic
983914890 4:173281526-173281548 ACGTTTCCACATGCTTCCAGTGG - Intronic
985496986 5:214279-214301 CGTTTTGCAGATGCTTCCACTGG + Intronic
986795793 5:11210803-11210825 TGTTTGGCAAATGTTTCCTGTGG + Intronic
987922569 5:24302781-24302803 AGTTTTGTACATTCATCCAGGGG + Intergenic
988258300 5:28849506-28849528 AGTATGGCACAATCTTCCTGGGG + Intergenic
988966036 5:36418890-36418912 GGTTTGCCACATGCTGCCTGTGG - Intergenic
989582809 5:43049115-43049137 ACTTTAGCTAATGCTTCCTGTGG - Intergenic
992322135 5:75623805-75623827 ATTTTTCCAAATGTTTCCTGGGG + Intronic
993210685 5:84946650-84946672 AGGTTTGGCCATGCTTCCAGAGG - Intergenic
995347081 5:111133435-111133457 AGGTTTCCACCTGCTCCCTGAGG + Intergenic
996414354 5:123194033-123194055 AGTTTTACCCATTCTTACTGTGG - Exonic
996726824 5:126679922-126679944 AGTTTTGCTCTTTGTTCCTGTGG - Intergenic
997699628 5:135887886-135887908 ACTTTTGCACTTGATTCTTGTGG - Intronic
997866163 5:137464711-137464733 AGGTCTGCACATGCTGACTGTGG + Intronic
999101019 5:149026483-149026505 ACATTTGGACTTGCTTCCTGTGG + Intronic
1001109922 5:168887104-168887126 AGCTTTTGAAATGCTTCCTGGGG + Intronic
1001571182 5:172731775-172731797 TGTGTTGAACAAGCTTCCTGGGG - Intergenic
1001753064 5:174146267-174146289 AGTTTAGAACATGCCTCCTGAGG - Intronic
1002853124 6:1014106-1014128 GTTTTTGCACATGCTTGCAGGGG + Intergenic
1003082660 6:3034262-3034284 AGTCTTGCACATGCCTTTTGAGG - Intergenic
1006207898 6:32365641-32365663 AGTTCTGCACATTTTTTCTGTGG + Intronic
1008446186 6:51594877-51594899 ACTTCTGCAGCTGCTTCCTGAGG - Intergenic
1008885580 6:56429253-56429275 ATTTTTGCAAATGCTGCCAGTGG + Intergenic
1010831585 6:80537288-80537310 AGTCTGGCTCATGCTTACTGGGG + Intergenic
1013189851 6:107792950-107792972 AGTTTTCCACTTGCTTCTGGGGG + Intronic
1013615145 6:111835901-111835923 TGTTTTTCACATTCATCCTGTGG - Intronic
1014236182 6:118957745-118957767 ACTTTTGTATATGGTTCCTGTGG + Intergenic
1015176742 6:130317698-130317720 AGTTTTCCAGTTGCTTCCAGTGG - Intronic
1016229349 6:141783867-141783889 AGATTTGCAAATGTTCCCTGAGG + Intergenic
1016471537 6:144379800-144379822 AGTTTTGCACATAGATGCTGTGG + Intronic
1019777439 7:2920960-2920982 AGTTTTGCAAATACTTTGTGAGG + Intronic
1019987911 7:4671329-4671351 TGGTTTGAACATGTTTCCTGTGG + Intergenic
1022526190 7:31038923-31038945 CATTTAGCACAGGCTTCCTGTGG - Intergenic
1023444969 7:40222018-40222040 AGTTCTGCAAATATTTCCTGTGG + Intronic
1023780393 7:43650071-43650093 ATTTCTGGACATGCTTCCTGTGG - Exonic
1024947556 7:54825582-54825604 AGCTTTGCAGAAGCTTTCTGTGG - Intergenic
1028713613 7:93939326-93939348 AGTTTGGCCCACACTTCCTGAGG + Intergenic
1030954360 7:115833470-115833492 AGTTTCTAACATGCTTTCTGGGG - Intergenic
1033446611 7:141428562-141428584 AGTTGTGCACATCCTCCATGAGG - Intronic
1037250239 8:16884665-16884687 ACTTTTGAAAATGCTTCCTTTGG - Intergenic
1039018775 8:33182767-33182789 AGCTATGCACATGCTTTCTTAGG - Intergenic
1042983784 8:74560447-74560469 ATTTTTGCATATGCTTTCTCTGG - Intergenic
1043494293 8:80783154-80783176 ACTTTTGCTCCTGCTCCCTGTGG - Intronic
1046400646 8:113699293-113699315 AGTTGTGCACATACTCACTGGGG + Intergenic
1046843303 8:118885615-118885637 ACTTTTCCAGATGCTGCCTGAGG + Intergenic
1048288532 8:133162095-133162117 AGTTTTGCACATGCTGTCCCTGG + Intergenic
1049059546 8:140265534-140265556 TGTTTTCCCCATCCTTCCTGTGG + Intronic
1049484427 8:142846479-142846501 AGTTTTGAAGATTTTTCCTGGGG - Exonic
1050078865 9:1893826-1893848 AGGTTTGCAGATGAGTCCTGAGG + Intergenic
1052469216 9:28872582-28872604 AGTTTGGTACATGCTTCCAAGGG + Intergenic
1053002822 9:34586598-34586620 AGTTTTGGACATCCCTTCTGTGG - Intronic
1056236278 9:84597895-84597917 ATTTTTTCAGAAGCTTCCTGGGG + Intergenic
1056910562 9:90696457-90696479 AGCTTTGCACGTGCTCCCTCAGG + Intergenic
1060175435 9:121494175-121494197 GGGTGTGCACGTGCTTCCTGGGG - Intergenic
1062293473 9:135810020-135810042 AGTTTTGCACATATTTTCTTGGG - Exonic
1185768705 X:2748394-2748416 AGTATTTTACATGCTTCTTGAGG - Intergenic
1187669470 X:21655432-21655454 AGTTTTGTATAAACTTCCTGTGG + Exonic
1187799825 X:23048823-23048845 AGTTTTGAACATCTTTCCTTGGG - Intergenic
1191722243 X:64242021-64242043 ATTTTTGCACATGATTGCTTTGG + Intergenic
1193084468 X:77437019-77437041 AGTTTTGTCCTTCCTTCCTGGGG + Intergenic
1193378588 X:80791285-80791307 GGTTTTGCACATACTTTGTGAGG + Intronic
1194034795 X:88856675-88856697 ATTTTTCCACTTGCTTTCTGAGG + Intergenic
1194667888 X:96695607-96695629 AATTTTTCACATTCTTCCTATGG + Intronic
1195423425 X:104700635-104700657 ACTTTTGCAATGGCTTCCTGAGG + Intronic
1196236838 X:113291698-113291720 AGGTTTTCCAATGCTTCCTGTGG - Intergenic
1197211859 X:123834685-123834707 AGTAGTCCACAGGCTTCCTGTGG + Intergenic
1198280860 X:135140861-135140883 ATTTTTTCATATGCTTCTTGTGG + Intergenic
1198290098 X:135231653-135231675 ATTTTTTCATATGCTTCTTGTGG - Intergenic
1199622817 X:149714661-149714683 AGTCCTGCACATGCTCTCTGGGG - Intronic
1199628511 X:149760959-149760981 AGTCCTGCACATGCTCTCTGGGG - Intergenic
1200854286 Y:7920584-7920606 AGTATGTCACATGCTCCCTGAGG + Intergenic
1201301673 Y:12510587-12510609 AGTATTTTACATGCTTCTTGAGG + Intergenic