ID: 941920987

View in Genome Browser
Species Human (GRCh38)
Location 2:170850524-170850546
Sequence AGGTAGAAGCAGACTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941920983_941920987 3 Left 941920983 2:170850498-170850520 CCATTGGGGCTGGAGCAAGGTGA No data
Right 941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941920987 Original CRISPR AGGTAGAAGCAGACTAAGGA GGG Intronic
No off target data available for this crispr