ID: 941925426

View in Genome Browser
Species Human (GRCh38)
Location 2:170889518-170889540
Sequence CTGGGAGCTTAGAATTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941925426_941925431 19 Left 941925426 2:170889518-170889540 CCTTGATAATTCTAAGCTCCCAG No data
Right 941925431 2:170889560-170889582 GGATGAAGAACCACTATTCCAGG No data
941925426_941925430 -2 Left 941925426 2:170889518-170889540 CCTTGATAATTCTAAGCTCCCAG No data
Right 941925430 2:170889539-170889561 AGATGATACTCAGGTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941925426 Original CRISPR CTGGGAGCTTAGAATTATCA AGG (reversed) Intergenic
No off target data available for this crispr