ID: 941933528

View in Genome Browser
Species Human (GRCh38)
Location 2:170965540-170965562
Sequence GTTTCCCCCAGTGCTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941933522_941933528 3 Left 941933522 2:170965514-170965536 CCTATCTATCTTTCTTCCCTGAG No data
Right 941933528 2:170965540-170965562 GTTTCCCCCAGTGCTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941933528 Original CRISPR GTTTCCCCCAGTGCTGGGCC AGG Intronic
No off target data available for this crispr