ID: 941933545

View in Genome Browser
Species Human (GRCh38)
Location 2:170965629-170965651
Sequence TTCCAGATAGAGGCCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941933545 Original CRISPR TTCCAGATAGAGGCCCTGGC AGG (reversed) Intronic
900303051 1:1987402-1987424 TTCCAGAGAGCGGGCCAGGCAGG + Intronic
900396944 1:2456981-2457003 TGACAGGTAGGGGCCCTGGCTGG - Intronic
900720932 1:4175302-4175324 TCCAAGATTGAGGCACTGGCAGG - Intergenic
900874915 1:5335265-5335287 TTCCAGATAGAGGCTTTGGAGGG - Intergenic
900900552 1:5513077-5513099 CTCCAGATAGGAGCCCAGGCTGG + Intergenic
901646817 1:10721202-10721224 CTCCAGACAGAGGGGCTGGCTGG + Intronic
901840335 1:11950220-11950242 TCCCAGATGGTGGCCCAGGCTGG + Intronic
902735630 1:18398978-18399000 CACCAGATGGATGCCCTGGCTGG + Intergenic
902967162 1:20013953-20013975 TTCAAGATTAAGGCTCTGGCAGG + Intergenic
903869060 1:26419157-26419179 TTTCAGATGCAGGCCCTGGGAGG + Intronic
903952499 1:27004526-27004548 TCCCAAATAGAGGCCCTACCTGG + Intergenic
904562650 1:31409163-31409185 TTCCAGATAGAGTCCCTTCCAGG + Intergenic
905251836 1:36654268-36654290 TTCCAGACAGAGGAAATGGCAGG - Intergenic
906662587 1:47593431-47593453 TTCCAGTTTGCCGCCCTGGCTGG + Intergenic
907048526 1:51314612-51314634 ATCCAGAGAGTGCCCCTGGCTGG - Intronic
907373190 1:54016131-54016153 TTCCAGGCAGAGGGCGTGGCAGG + Intronic
907703931 1:56816684-56816706 TTCAAGGAAGAGGCCCAGGCAGG - Intronic
908783640 1:67714256-67714278 GTTCAAATAGAGGGCCTGGCAGG - Intronic
915091793 1:153431446-153431468 CTGCAGAAAGAGGGCCTGGCTGG - Intergenic
916520575 1:165560115-165560137 ATACAGACAGTGGCCCTGGCTGG + Intronic
916927907 1:169542314-169542336 TTCCAGAATGAGGCCCTGGAAGG - Exonic
916927918 1:169542365-169542387 TTCCGGAATGAGGCCCTGGGAGG - Exonic
918098141 1:181351137-181351159 TTGCAGATAGAGCCAGTGGCTGG + Intergenic
918115245 1:181490504-181490526 CTTCAGAGAGAGGCCCTGCCTGG + Intronic
918354709 1:183696601-183696623 GTTCAGATAGAGGCCTGGGCTGG - Intronic
920193668 1:204212035-204212057 TTCCAGGTAGAGGCCTGGGCTGG - Intronic
921415736 1:214884680-214884702 CCCCAGAAAGAGACCCTGGCAGG + Intergenic
921675222 1:217968745-217968767 TTCCAGGTGGAGTCCATGGCAGG + Intergenic
923046498 1:230359910-230359932 TTGGAGGAAGAGGCCCTGGCTGG + Intronic
924513039 1:244743563-244743585 TTGCAAATGGAGGCCCTGGAAGG + Intergenic
924636852 1:245796421-245796443 TGCCAAATAGAGACCCTGCCAGG + Intronic
1064623844 10:17242132-17242154 TCCAAGATAGAGGTGCTGGCAGG + Intergenic
1067276017 10:44834766-44834788 TTGCAGACAGAGGCCAGGGCAGG + Intergenic
1069749216 10:70734962-70734984 TTCCAGATATAGTCACTGGTGGG + Intronic
1070969300 10:80550176-80550198 CTCCAGATGGAGGGCCTGTCAGG + Intronic
1071089560 10:81902576-81902598 TCCAAGATCGAGGCCCTGGCAGG - Intronic
1071727438 10:88213592-88213614 TTCAAGATGGCGGCTCTGGCAGG - Intergenic
1071920679 10:90346533-90346555 TTCCAGATAAAGACGTTGGCTGG - Intergenic
1071992058 10:91109187-91109209 TTCCAGATAGATTTCCTGCCTGG + Intergenic
1072759755 10:98046839-98046861 TTACAGATAGAGACCCTTGAAGG + Intergenic
1073578777 10:104645137-104645159 TTCCAGCCAGAGCACCTGGCAGG - Intronic
1075354863 10:121762488-121762510 TGCCACACAGTGGCCCTGGCAGG - Intronic
1075912382 10:126135814-126135836 TTCCCGACATAGACCCTGGCTGG - Intronic
1076555270 10:131317470-131317492 GTCCAGATTGAGCCCCTGGTGGG + Intergenic
1076802826 10:132839315-132839337 TTCCACAGAGATGGCCTGGCAGG - Intronic
1077277288 11:1718893-1718915 TTCAACAAAGAGGCCCTGACAGG - Intergenic
1078001192 11:7497465-7497487 TTCCAGAAGGAGGCACTGGAAGG + Intronic
1078266069 11:9757138-9757160 CTGCTGATAGAGGCCCTGGGAGG - Intergenic
1078466182 11:11552256-11552278 TTCCAGATTTTGGCCATGGCAGG - Intronic
1080608111 11:33881317-33881339 TTCCAGATGGAGGGCCACGCAGG - Intronic
1080874961 11:36266608-36266630 TTCCAGAGAGAGGGCATGGCGGG + Intergenic
1081268088 11:41051726-41051748 TTTAACATAGAGGCCCAGGCTGG - Intronic
1084337555 11:68469406-68469428 TTTGAGATAGAGTCCCAGGCTGG + Intronic
1084428308 11:69097540-69097562 TTGCTGATCGAGGCGCTGGCGGG + Intergenic
1085857080 11:80187394-80187416 TTCAAGATGGAGGTGCTGGCAGG + Intergenic
1086060262 11:82693052-82693074 TTCAAGATTAAGGCTCTGGCAGG + Intergenic
1087128657 11:94650669-94650691 CACCAGAGAGTGGCCCTGGCTGG - Intergenic
1087779829 11:102290461-102290483 TCCAAGATGGAGGCACTGGCAGG + Intergenic
1088137910 11:106579543-106579565 TCCAAGATACAGGCACTGGCAGG + Intergenic
1088287321 11:108202150-108202172 TTCCAGATAGTGGCATGGGCAGG - Intronic
1088991151 11:114954648-114954670 TCCAAGATAAAGGCCCTGGAAGG + Intergenic
1089081090 11:115776742-115776764 TCCCAGAAAGAGCCCCTGCCTGG - Intergenic
1089676970 11:120096779-120096801 TTCCAGAAAGAGGACCTGAAGGG + Intergenic
1089987002 11:122824219-122824241 TTCCAGAGAGAGCCCCTCTCTGG + Intergenic
1090034100 11:123233297-123233319 TCCAAGATCAAGGCCCTGGCAGG - Intergenic
1090230263 11:125097772-125097794 TACCAGTTAGACACCCTGGCTGG + Intronic
1094097834 12:26727932-26727954 TTCCAAACAGAGCCACTGGCTGG + Intronic
1094793725 12:33945607-33945629 TTCCAGATAGAGTCCATGACTGG + Intergenic
1096311233 12:50522597-50522619 ACACAGATAGTGGCCCTGGCTGG + Intronic
1096574043 12:52541542-52541564 TTCCAGGAAGAGGCCATCGCAGG - Intergenic
1096847015 12:54412868-54412890 TGCCAGATACAAGTCCTGGCAGG - Intronic
1097763909 12:63500519-63500541 TTCCGGATAGAGTCCATGACTGG - Intergenic
1101690549 12:107076068-107076090 TTCAAGATAGAGGCCAGTGCAGG + Intronic
1102065050 12:109967934-109967956 TTGCAGATGGAGTCCCTGTCTGG - Intronic
1102095927 12:110241371-110241393 TTCCAGAGAGAGGTCAGGGCTGG + Intergenic
1102506137 12:113385530-113385552 ATCCAGTCAGAGACCCTGGCAGG - Intronic
1104599295 12:130141737-130141759 TTCCAGAGAGAGGGCAGGGCTGG + Intergenic
1107575138 13:41710831-41710853 TTCCAAAGAGAGGCCCTGGCAGG + Intronic
1107650161 13:42536724-42536746 TATCAGATGGAGGCCCTGACAGG + Intergenic
1109202161 13:59442569-59442591 TTCAAGATAGCTCCCCTGGCAGG - Intergenic
1109829658 13:67770253-67770275 GTCCAGATAGAGCCCATGACCGG - Intergenic
1113728673 13:112624438-112624460 TTCCACTTAGAGCCCCAGGCTGG + Intergenic
1117500888 14:56350215-56350237 TTACAGAAAGAAGCCTTGGCAGG - Intergenic
1118332105 14:64822946-64822968 TCCCGGATAAAGGCCTTGGCAGG - Exonic
1120624428 14:86807214-86807236 TCCAAGGTCGAGGCCCTGGCAGG + Intergenic
1121278110 14:92681242-92681264 TGCCACCTAGTGGCCCTGGCAGG + Intronic
1121374227 14:93391723-93391745 ATCTAGATACAGGCCTTGGCAGG - Intronic
1122310433 14:100791010-100791032 CACCAGATAAAGGCCCTGCCCGG + Intergenic
1125234125 15:37491741-37491763 TTCCAGATAGAGGACATTGCTGG + Intergenic
1126777731 15:52113528-52113550 TCCAAGGTTGAGGCCCTGGCAGG + Intergenic
1127093836 15:55493176-55493198 GTCCAGATCAAGGTCCTGGCAGG - Intronic
1129385902 15:75195994-75196016 CTCCAGGGAGAGGCCCTGGATGG + Intronic
1132252555 15:100344952-100344974 TGCCAAAAAGAGGCCCTGGCAGG - Intergenic
1132315681 15:100888799-100888821 TTCTAGGCAGAGTCCCTGGCAGG + Intronic
1132355858 15:101170745-101170767 TTCCAGACAGAGGGCCTGTTTGG - Intergenic
1133531947 16:6663515-6663537 TTCTAGAAAGAGGCCCTTCCAGG - Intronic
1133887666 16:9845674-9845696 TTCCAGGTAGAGGCAATGGCAGG - Intronic
1134244979 16:12533147-12533169 GTTCAGAGAGAGGCCCTGCCTGG - Intronic
1134990660 16:18696227-18696249 TACGAGATAGAGGCCCAGGATGG + Intergenic
1135689238 16:24522895-24522917 TTCCAGATAGTGGCCCCGGCTGG - Intergenic
1135947236 16:26875881-26875903 TGCCTGAAAGAGGCCTTGGCAGG - Intergenic
1137547263 16:49413022-49413044 TTCCAGGTACAGTCCCTGCCTGG + Intergenic
1140958021 16:79885478-79885500 TTCCAGGTAGCGGGCCTGCCCGG - Intergenic
1141853421 16:86664360-86664382 TTCCCCAAAGAGGCCGTGGCGGG - Intergenic
1144064724 17:11614653-11614675 TTCGAGATCAAGGCACTGGCAGG + Intronic
1144889984 17:18489042-18489064 TTCAACACAGAGGCCCTGGGTGG + Intronic
1145142232 17:20455275-20455297 TTCAACACAGAGGCCCTGGGTGG - Intronic
1145793679 17:27643626-27643648 TTCAACACAGAGGCCCTGGGTGG + Intronic
1145808490 17:27751182-27751204 TTCAACACAGAGGCCCTGGGTGG + Intergenic
1145866297 17:28244026-28244048 TTTGAGATGGAGGCCCAGGCTGG + Intergenic
1145886835 17:28387916-28387938 TTCCAGAGAGAGGTCAGGGCTGG + Intronic
1146647400 17:34584271-34584293 TTCCAGATGGAGGGGCTGGTGGG - Intronic
1146832803 17:36084405-36084427 TTCCTGTGAGAGGCCCTGGGTGG - Intergenic
1146847276 17:36190711-36190733 TTCCTGTGAGAGGCCCTGGGTGG - Intronic
1149358098 17:55864870-55864892 TTCAAGATCAAGGCACTGGCTGG - Intergenic
1150004103 17:61459038-61459060 CTCCTGATAGAGGCCCTGAGTGG - Intronic
1150158998 17:62878221-62878243 TTTGAGATATAGGCCCTGGAGGG + Intergenic
1151775386 17:76197835-76197857 TGCCAGATTCAGGCCCTGGTAGG + Intronic
1152364659 17:79848645-79848667 TTCCCCAGATAGGCCCTGGCAGG + Intergenic
1153517597 18:5918699-5918721 TTCCAGATTGAGGCAGGGGCGGG - Intergenic
1157274983 18:46304075-46304097 TTCCAGAGAGAGTCCCTGGGAGG - Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1158259800 18:55593985-55594007 CTCCAGATTGAGGTCCTAGCTGG - Intronic
1161374287 19:3931219-3931241 GCCCAGATAAAGGCCCTGGCAGG - Intergenic
1161752184 19:6106035-6106057 GTCCAGAGAGAGGCCCTAACAGG - Intronic
1162601534 19:11673859-11673881 TTCCAGACACAGCCCTTGGCAGG - Intergenic
1162612905 19:11769968-11769990 ATCAAGAAAGAGGCCCAGGCTGG - Intronic
1163544360 19:17932361-17932383 ATCCAGGAAGAGGCACTGGCAGG + Intergenic
1163957517 19:20658172-20658194 TTACAGATAGTGGCCCAGGTGGG + Intronic
1164000338 19:21092506-21092528 TTACAGATAGTGGCCCAGGTGGG - Intronic
1164261380 19:23570931-23570953 TTCCAGATAGGGGGCCGTGCAGG - Intronic
1164692431 19:30221507-30221529 GCACAGATAGTGGCCCTGGCTGG + Intergenic
1164876359 19:31693498-31693520 TTACAGACAGATGCTCTGGCAGG + Intergenic
1165730098 19:38139776-38139798 TTCAAGATCCAGGCACTGGCAGG + Intronic
1166846252 19:45730551-45730573 ATCCAGGTAGAGGCCCTGAAGGG - Intronic
1166980559 19:46629767-46629789 TTCCAGATGCAGGCCTGGGCTGG - Intergenic
1167422720 19:49413560-49413582 GTCCAATTAGAGGCCTTGGCAGG - Intronic
1167675703 19:50883915-50883937 GTCCAGATAGAGGGTGTGGCTGG + Intergenic
1167744510 19:51342648-51342670 CTCAGGATAGAGGCCCTGGCAGG - Intergenic
926696839 2:15776022-15776044 TTCAAGATCTAGGCACTGGCAGG - Intergenic
927410351 2:22817877-22817899 GTCCAGAGAGAGGCCATGCCAGG + Intergenic
927992252 2:27456453-27456475 CTCTAGATAGTGGCTCTGGCTGG + Intronic
928094660 2:28396507-28396529 TCCCAGATATATGCCCTGCCTGG + Intronic
928155130 2:28869821-28869843 TTCCAGAGAGAGACCCTTTCAGG - Exonic
932052939 2:68417074-68417096 TTCCAGATAGAGTCCATGACCGG - Intergenic
933670189 2:84999839-84999861 TCCCAGTTAGAGGCCCTGACAGG + Intronic
934034253 2:88075956-88075978 TTCCAGAAAGAGGCACTGATAGG - Intronic
935591875 2:104852510-104852532 TGCCAGATGCAGGCTCTGGCTGG + Intergenic
937314606 2:120922984-120923006 TTCCAGAAAGAGGCCTGGGGAGG - Intronic
937564577 2:123268562-123268584 TTCAAGATAGAGGTCTTGGCTGG + Intergenic
939005647 2:136783662-136783684 TTCCAACTGGAGGGCCTGGCAGG - Intronic
941048506 2:160704263-160704285 TTCCAGATTGCAGCCCTGCCAGG + Intergenic
941933545 2:170965629-170965651 TTCCAGATAGAGGCCCTGGCAGG - Intronic
942285572 2:174412644-174412666 TTCTAGCTAGAGGACCTGGAAGG + Intronic
943351871 2:186805877-186805899 CACCAGATAGGGCCCCTGGCTGG - Intergenic
945657968 2:212648785-212648807 TTCAAGATCAAGGCTCTGGCAGG + Intergenic
945898019 2:215506195-215506217 CTCCAGCTAGAGGCCCTACCAGG - Intergenic
946198044 2:218050004-218050026 TTCTAGATAGAGTCCATGACTGG + Intronic
946777835 2:223162075-223162097 ACCCAGATAGTGGGCCTGGCTGG + Intronic
946830713 2:223725708-223725730 TTCCAGCCGGAGGCCCTGGGAGG + Intergenic
948087726 2:235265531-235265553 GGCCAGCTGGAGGCCCTGGCAGG + Intergenic
948469379 2:238167455-238167477 TCCCAGGTAGGGGCCCTGGCTGG - Intronic
948511322 2:238467114-238467136 TTCAAGATCAAGGCACTGGCAGG + Intergenic
948840047 2:240644426-240644448 TTCCGGAGAGAAGCCCAGGCAGG + Intergenic
1168955533 20:1831999-1832021 CTCCCCATAGATGCCCTGGCTGG - Intergenic
1169421515 20:5464585-5464607 TTCCAGGTGGAGTCCCTGACTGG + Intergenic
1170078008 20:12441373-12441395 TTCCAGACAGAGTCTCAGGCTGG + Intergenic
1170832882 20:19858824-19858846 TTTCATAAAGAGACCCTGGCAGG + Intergenic
1171178548 20:23074339-23074361 GTACAGATGCAGGCCCTGGCAGG - Intergenic
1173454622 20:43192199-43192221 TTCCAGGCAGAGGGACTGGCCGG - Intergenic
1175374565 20:58515325-58515347 TTACAGACAGAGGCCGGGGCTGG - Intergenic
1178253806 21:31031906-31031928 CTCCAGATAAAGGCCCAGACTGG - Intergenic
1180106350 21:45620747-45620769 TTCCAGTTGGGGGCCCGGGCAGG + Intergenic
1180128283 21:45806658-45806680 TTCACTAGAGAGGCCCTGGCTGG - Intronic
1181368953 22:22401244-22401266 ATCCAGAAAGAGACCCTTGCAGG - Intergenic
1182011158 22:27001746-27001768 TTCCAGAGAGAGTCCCTTCCTGG - Intergenic
1182658075 22:31905569-31905591 TTCCAGTGAGAGGCCCAGGATGG + Intronic
1182897559 22:33871419-33871441 TTCCAGATGGAGCACCTGGCAGG - Intronic
1183465080 22:37975782-37975804 TTCCAGAAAGAGGCAATGCCTGG - Intronic
1183986161 22:41571837-41571859 TTCCAGACGGAGCCCGTGGCTGG + Exonic
1184489911 22:44802530-44802552 TCCCAGAGAGAGGCCCAGGGAGG - Intronic
1185137996 22:49084210-49084232 GTCCAGAAAGAGACCCTGCCTGG - Intergenic
950431868 3:12955492-12955514 CACCAGGCAGAGGCCCTGGCTGG - Intronic
950572294 3:13808951-13808973 TAGCAGAGAGAGGCCCAGGCTGG + Intergenic
952310656 3:32186315-32186337 TTCCAGAGAGAGGCTCTGACTGG + Intergenic
953338889 3:42117392-42117414 TGCCAGAAAGAGGCAATGGCAGG - Intronic
953569478 3:44059641-44059663 TTCCAGATCAAGGCCTCGGCTGG - Intergenic
953790945 3:45947499-45947521 TTCCAGTTATAGGCCTTGCCAGG + Exonic
955056080 3:55457247-55457269 TGCCAGATAGAGCACCTGGTAGG + Intergenic
955158989 3:56446275-56446297 TTCAAGATAGAAGTCCAGGCTGG + Intronic
958465570 3:94453629-94453651 TTCCAGATAGAGTCCATGACTGG + Intergenic
961041511 3:123681852-123681874 ATCCAGAAAGAGCCCCTGGGAGG + Intronic
961061384 3:123831950-123831972 GTCTAGGGAGAGGCCCTGGCAGG + Intronic
961368863 3:126417712-126417734 ATCCCGGCAGAGGCCCTGGCTGG - Intronic
963230571 3:142905214-142905236 TTCCAGATAGAGGCAGTAACAGG - Intergenic
964222888 3:154367049-154367071 TTCAAGATCAAGGCTCTGGCAGG + Intronic
965178545 3:165367905-165367927 TTCCAGATAGAGTCCAAGACTGG - Intergenic
965476005 3:169155919-169155941 TTCAAGAAAGAGGGCCTGGAAGG - Intronic
966058033 3:175719819-175719841 TTCAAGATCAAGGCACTGGCAGG + Intronic
967146789 3:186613116-186613138 TGCCCCAGAGAGGCCCTGGCAGG - Exonic
967628614 3:191715737-191715759 CTCCAGATAAAAGCCCAGGCTGG + Intergenic
970193366 4:13534917-13534939 TTCCTCACAGAGGACCTGGCCGG - Intergenic
970454780 4:16212318-16212340 GTCCAAATACAGGCCCTGGCAGG + Intronic
970858782 4:20678232-20678254 TCCAAGATCGAGGCACTGGCAGG + Intergenic
971821771 4:31566244-31566266 TTCCAGATAGAGTCCATGGCTGG - Intergenic
971877259 4:32323281-32323303 TGCCAGGCAGTGGCCCTGGCTGG - Intergenic
973182657 4:47288556-47288578 ATTAAGATAGAAGCCCTGGCTGG - Intronic
973933590 4:55818773-55818795 TTCAAGATCAAGGCACTGGCAGG + Intergenic
974885249 4:67809833-67809855 GTCCAGCTCGAGCCCCTGGCTGG - Intergenic
977817216 4:101428942-101428964 GTTCAGAGAGAGGCCCTGTCAGG - Intronic
978382750 4:108147106-108147128 TTACAGAGAGAGGCCCGGGAGGG + Intronic
979055292 4:115986145-115986167 TTCCAGATGGAGTCCATGACTGG + Intergenic
980561006 4:134475559-134475581 TTCCCGATAGAGTCCCTGACTGG - Intergenic
980897501 4:138874206-138874228 ATCCAGATAGATGACCTGGCTGG + Intergenic
981177141 4:141694704-141694726 TTCAGGATAGAGGTCCAGGCTGG - Intronic
984252839 4:177355042-177355064 TTCCAGATAAAGGGACTGGGAGG - Intronic
984760758 4:183360729-183360751 TCCCAGATCAAGGCCCTGTCAGG - Intergenic
987302017 5:16605705-16605727 TTCAAGATCAAGGCACTGGCAGG + Intronic
989537618 5:42582292-42582314 TTCCAGGTGGAGTCCTTGGCTGG + Intronic
997404882 5:133637782-133637804 TTCAAGAGAGAGGTCCAGGCTGG - Intergenic
999376429 5:151089607-151089629 TTCCAGTTAGAATACCTGGCTGG + Intronic
999853117 5:155564426-155564448 TTCAACAAAGAGGCCCTGGCGGG - Intergenic
1004403452 6:15310296-15310318 TTCCACAAAGAGGCTATGGCAGG - Intronic
1006033985 6:31197814-31197836 TTCCAGATCGCGCCCCAGGCTGG + Exonic
1006651342 6:35554371-35554393 TTAAATATAGAGGCCCTGGCCGG + Intergenic
1006922405 6:37635463-37635485 TTTCAGACAGAGGCCTTGACTGG + Exonic
1007246916 6:40469704-40469726 TGCTTCATAGAGGCCCTGGCAGG + Intronic
1008252365 6:49255886-49255908 TTCCAGAGCAAGGACCTGGCTGG - Intergenic
1008355871 6:50552532-50552554 TTCAAGATTAAGGCACTGGCTGG + Intergenic
1011725988 6:90211290-90211312 TTCCATAGCGAGGACCTGGCTGG - Intronic
1014288397 6:119529509-119529531 TTCCAGATAGAATCCCAGGGAGG - Intergenic
1014449396 6:121565673-121565695 TTCCACATAGAGTCCCTACCGGG + Intergenic
1016742920 6:147547347-147547369 CTCCAGATAGGAGCCCCGGCTGG - Intronic
1017344229 6:153361486-153361508 ACACAGACAGAGGCCCTGGCTGG - Intergenic
1018561171 6:165102231-165102253 TTCCGGATAGAGTCCATGACTGG + Intergenic
1018811990 6:167305048-167305070 TGCCAGACACAGGCCCTTGCTGG - Intronic
1019916990 7:4140024-4140046 TTCCAGAGTGTGGGCCTGGCAGG - Intronic
1020109838 7:5441821-5441843 TTCCAGGAAGAGGCAATGGCAGG - Intronic
1020644645 7:10800110-10800132 TTCCAGAGAGAAGCACAGGCAGG - Intergenic
1022092339 7:27115752-27115774 GGGCGGATAGAGGCCCTGGCCGG - Intronic
1024527451 7:50360849-50360871 TTCCATATCTAGGCCCTGTCAGG - Intronic
1024953244 7:54887845-54887867 TTCCAAATAGAGTCCCTGCCAGG + Intergenic
1032198621 7:129804196-129804218 TCCCAGATGGAGGCCCTGCCAGG + Intergenic
1033280955 7:140006035-140006057 TTCCAGTTACAGGCGCTGGGAGG - Intronic
1033980228 7:147155292-147155314 GTCCAGATCAAGGCACTGGCAGG - Intronic
1034275247 7:149821156-149821178 TTGCAGAGTGAGGCCCTGGGTGG - Intergenic
1034417234 7:150971565-150971587 TTCCAGATAGAGGCTCCGAGGGG + Intronic
1034979835 7:155468453-155468475 TTCCAGACAAAGGACTTGGCGGG - Intergenic
1035171663 7:157020803-157020825 TTCCAAGTAAAGGCCCAGGCCGG - Intergenic
1036001301 8:4608047-4608069 TTCCAGGTGAAGGCCCTGGGAGG + Intronic
1036091250 8:5668200-5668222 TTCCTGAATGAGGCCCTGACAGG + Intergenic
1039838091 8:41273460-41273482 TTTGAGACAGAGGCCCAGGCTGG - Intronic
1043731792 8:83693209-83693231 TTCTAGGTAGATGCCCTGTCCGG + Intergenic
1043887280 8:85615902-85615924 TTCCAAATAGAACCACTGGCTGG - Intergenic
1044311611 8:90699664-90699686 CTCCAGATAGAGGCCCTTCTGGG - Intronic
1045690003 8:104750594-104750616 TCCCAGATAGTGTCCCTTGCTGG - Intronic
1048818386 8:138355659-138355681 TTCAAGGAAGAGACCCTGGCAGG + Intronic
1048826472 8:138432322-138432344 TCCCAGATAGAGGGACTTGCTGG + Intronic
1049263417 8:141652174-141652196 TGCCAGAAAGAGGCCATGGGTGG - Intergenic
1049607400 8:143536141-143536163 ATGCTGGTAGAGGCCCTGGCTGG - Intronic
1049851823 8:144836716-144836738 TTCTAAACAGAGGCCTTGGCTGG + Intronic
1056507994 9:87275545-87275567 TTCCAGAGAGAGGAAATGGCAGG + Intergenic
1058140658 9:101354219-101354241 TTCAAGATCAAGGCACTGGCCGG + Intergenic
1059927248 9:119222153-119222175 TTCCAGATAGGGGCCATCGGAGG + Intronic
1061016100 9:127981420-127981442 GCCCAGAGAGAGCCCCTGGCAGG + Intergenic
1062431307 9:136527948-136527970 TTCCATGGAGCGGCCCTGGCAGG - Intronic
1186513702 X:10150234-10150256 TTCAAGATGAAGGCACTGGCAGG + Intergenic
1188622248 X:32240458-32240480 TTCAAGATCAAGGCACTGGCAGG - Intronic
1188936726 X:36185136-36185158 TCCAAGATAAAGGCACTGGCAGG + Intergenic
1194431388 X:93811237-93811259 TTCCATAAAGAGGCAATGGCAGG + Intergenic
1196997596 X:121401087-121401109 TTCAAGATCAAGGCACTGGCAGG - Intergenic
1199111868 X:143945239-143945261 ATACAGACAGTGGCCCTGGCCGG - Intergenic
1200101855 X:153692288-153692310 CTGGGGATAGAGGCCCTGGCAGG + Intronic