ID: 941934023

View in Genome Browser
Species Human (GRCh38)
Location 2:170969399-170969421
Sequence GCCCTAAGGGAGCTCACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941934017_941934023 24 Left 941934017 2:170969352-170969374 CCTACATTTTAGCAGGTGGAGAA No data
Right 941934023 2:170969399-170969421 GCCCTAAGGGAGCTCACAGTAGG No data
941934015_941934023 29 Left 941934015 2:170969347-170969369 CCAGACCTACATTTTAGCAGGTG No data
Right 941934023 2:170969399-170969421 GCCCTAAGGGAGCTCACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941934023 Original CRISPR GCCCTAAGGGAGCTCACAGT AGG Intergenic