ID: 941934023

View in Genome Browser
Species Human (GRCh38)
Location 2:170969399-170969421
Sequence GCCCTAAGGGAGCTCACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 12, 3: 40, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941934015_941934023 29 Left 941934015 2:170969347-170969369 CCAGACCTACATTTTAGCAGGTG 0: 1
1: 0
2: 0
3: 12
4: 86
Right 941934023 2:170969399-170969421 GCCCTAAGGGAGCTCACAGTAGG 0: 1
1: 0
2: 12
3: 40
4: 207
941934017_941934023 24 Left 941934017 2:170969352-170969374 CCTACATTTTAGCAGGTGGAGAA 0: 1
1: 0
2: 3
3: 18
4: 294
Right 941934023 2:170969399-170969421 GCCCTAAGGGAGCTCACAGTAGG 0: 1
1: 0
2: 12
3: 40
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941934023 Original CRISPR GCCCTAAGGGAGCTCACAGT AGG Intergenic
900463719 1:2813556-2813578 GCCCCACGGGAGCCCACAGTGGG - Intergenic
900787160 1:4656025-4656047 GCCCGACGGGCGCTCACAGCTGG + Intronic
901689511 1:10963621-10963643 GCCATGAAAGAGCTCACAGTTGG + Intronic
902074478 1:13772471-13772493 GCCCTAAGGGATCTGACTGTAGG - Intronic
902159271 1:14516679-14516701 GCCCTCAAGGAGCTGACAGTTGG - Intergenic
903349222 1:22708155-22708177 GCCCTCATGGAGCTCACAGTCGG + Intergenic
903373705 1:22852862-22852884 GCCCTCATGGAGCTCACAGCTGG + Intronic
905369802 1:37476903-37476925 GCCCTGAGGGAGCTCCTAGGTGG + Intronic
906100494 1:43257320-43257342 GCCCTAAGGCTGCTTACAGGAGG - Intronic
907335267 1:53695480-53695502 GCCTTCAGGGAGCTCCCAGCTGG - Intronic
907817743 1:57936988-57937010 GCCCAAAGGGAGCTGACAAAGGG - Intronic
908065690 1:60401696-60401718 GCCCTCAGGGAGTTTACATTTGG - Intergenic
908262070 1:62346930-62346952 GGCCTCATGGATCTCACAGTCGG + Intergenic
908822931 1:68106341-68106363 GGCCTAAGGGAGCCCTCAGTGGG + Intronic
913193593 1:116433897-116433919 GCCCTTGGGGTGCTTACAGTGGG + Intergenic
913525481 1:119687953-119687975 ATCCTTAAGGAGCTCACAGTAGG - Intronic
915116416 1:153603490-153603512 GCACTGAGGGAGATCCCAGTAGG - Intergenic
915179467 1:154045733-154045755 GCACTTCGGGAGGTCACAGTGGG + Intronic
915908874 1:159900004-159900026 GGCCTAGGGGAGGTCACAGTTGG - Intronic
916120499 1:161524665-161524687 GCCCCACGGGAGCTCGCGGTGGG + Exonic
916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG + Intronic
917717060 1:177748904-177748926 GCCCACAAAGAGCTCACAGTGGG + Intergenic
917927399 1:179800625-179800647 CCCCTCAAGGAGCTCACAGGAGG - Intronic
917999902 1:180483456-180483478 GCTCTTAGGAAGCTTACAGTCGG - Intronic
918555213 1:185791123-185791145 GTAGTAAGGGAGCCCACAGTAGG - Intronic
919973806 1:202598056-202598078 GCTCTCAAGGACCTCACAGTGGG - Intronic
924151802 1:241137231-241137253 TCCCTCAAGGAGCTCACAGCAGG - Intronic
924315473 1:242790729-242790751 TCCCAAAGGCAGCTCACAGCAGG + Intergenic
1065693110 10:28355356-28355378 GCACTTAGGGAGGTCAAAGTGGG - Intergenic
1067066927 10:43109391-43109413 GGCCTGGGAGAGCTCACAGTGGG + Intronic
1067338570 10:45383064-45383086 GCCCTCCGTGAGATCACAGTAGG + Intronic
1069663691 10:70140400-70140422 GCCCTTATGGAGCTGACACTAGG - Intronic
1070352113 10:75602467-75602489 GCCATAAAGGAGCTCAATGTTGG + Intronic
1071756897 10:88552334-88552356 GTTCTTAAGGAGCTCACAGTGGG - Intronic
1071895319 10:90060174-90060196 TCCCTAAGGGAGCATAGAGTTGG + Intergenic
1073582164 10:104678618-104678640 GCCCTCAGGAGGCTAACAGTAGG - Intronic
1074603485 10:114937926-114937948 GCTCTAATAGAGCTCACATTTGG + Intergenic
1075172766 10:120131266-120131288 GCCCTAAGGGAGCGGAAACTGGG - Intergenic
1075865260 10:125713340-125713362 GCCTTTGAGGAGCTCACAGTCGG + Intergenic
1076047411 10:127305585-127305607 GCCCTCAGGGAGCTCAGACAAGG + Intronic
1077871735 11:6268617-6268639 GCCATTTGAGAGCTCACAGTGGG - Intronic
1078180526 11:9006309-9006331 GCCCTAGGGGCCCTCACTGTTGG - Intergenic
1078463074 11:11530194-11530216 GCCCTAAAGCAACTCAGAGTGGG + Intronic
1078600725 11:12728056-12728078 GCCCTCAAGGTGCTCTCAGTTGG + Intronic
1078760242 11:14245761-14245783 TCCCTAAGGAAGCTCACACCAGG + Intronic
1079312474 11:19378840-19378862 GCCCTCAGGGAGCTCAGAGCGGG - Intronic
1079655209 11:22978189-22978211 GCTCTCAAGGAGCTCATAGTAGG - Intergenic
1081890324 11:46536268-46536290 GCCTTCAGGGAGCTCACTGACGG + Intronic
1085260984 11:75204571-75204593 GCCCCAAGACAGCTCACACTCGG - Exonic
1085283078 11:75343421-75343443 TCCCTGGGGGAGCTCACAGCTGG + Intronic
1086050800 11:82588230-82588252 GCCCTAAGGGAGCTTAAAAAGGG + Intergenic
1086072322 11:82813019-82813041 GCCATAAAGGAGATCATAGTTGG + Intergenic
1088692476 11:112339444-112339466 GTCTTATGGAAGCTCACAGTGGG + Intergenic
1089629393 11:119774690-119774712 GTCCTCAAGGGGCTCACAGTGGG - Intergenic
1089964782 11:122647025-122647047 GCCCTAAGGAAGCTCCTAGGAGG + Intergenic
1090347008 11:126079742-126079764 GCCCTTAGGGAACTCACTATAGG + Intergenic
1091715557 12:2773791-2773813 GCCCTTAGCGAGCTCACTGTAGG - Intergenic
1093112171 12:15165458-15165480 TCCCTAAGGGAACTCACAAATGG + Intronic
1096407895 12:51357220-51357242 GCCCTCAGGAAGCTTCCAGTCGG - Intronic
1096590794 12:52658040-52658062 GCCCCTAAGGAGCTTACAGTTGG - Intergenic
1101493096 12:105228036-105228058 GCCGTTGGGGAGCTGACAGTTGG - Intronic
1102123187 12:110459143-110459165 GGCCTCATGGAGCTCACATTTGG - Intronic
1102242022 12:111330342-111330364 GCCTTCAAGGGGCTCACAGTTGG + Intronic
1103318280 12:120074509-120074531 GCCCTAAGGGAGCTCATGGAGGG + Intronic
1103388375 12:120551933-120551955 GCCCTCAGGGAACTTACAGCGGG + Intronic
1103507011 12:121448525-121448547 GGCCTCAGGGGGCTCACAGCCGG - Intronic
1103850577 12:123930339-123930361 GCCCCCAGGGTGCACACAGTAGG + Exonic
1104276083 12:127329126-127329148 GCCCTGAGGGAGCCCAAAATGGG + Intergenic
1105255656 13:18742822-18742844 GCCATGAGGGAGCTCAGAGTGGG - Intergenic
1107467299 13:40663136-40663158 GCCCTTGGGCAGCTCCCAGTGGG - Intronic
1108278840 13:48840529-48840551 ACCCTGATGGAGCTCACAGAGGG - Intergenic
1109627454 13:64994036-64994058 TCCCTAAGAGAGCTCTGAGTGGG - Intergenic
1111292231 13:86185293-86185315 CCTCTAAGGGAGCACACAGATGG - Intergenic
1114303235 14:21396819-21396841 GCCCTTTGGGAGGCCACAGTGGG - Intronic
1114731633 14:24999501-24999523 GCTCTAAAGAAGCTCACAGATGG + Intronic
1117311964 14:54534963-54534985 GCCCTTTGGGAGATCACAGTGGG - Intronic
1121304993 14:92900496-92900518 GCCCCAGGAGAGCTGACAGTTGG - Intergenic
1122026887 14:98884655-98884677 GCCCTAAGAGTGATCTCAGTAGG + Intergenic
1122882250 14:104695381-104695403 GCCCTCAGGGAGCACCCCGTTGG + Intronic
1124354367 15:28984152-28984174 GCCCTGGAGGGGCTCACAGTGGG + Intronic
1124440028 15:29678869-29678891 CCCCTAAGGGACCTCAGACTGGG + Intergenic
1127539182 15:59920277-59920299 TCTCTTATGGAGCTCACAGTGGG - Intergenic
1127954736 15:63843631-63843653 GCTCTCAGGGAACTCACAGCTGG - Intergenic
1129113662 15:73352878-73352900 GCCCTTGGGGAGCTCACAGTAGG - Intronic
1129115307 15:73362306-73362328 GCCCTCAGGGAGCTCAGTTTGGG + Intronic
1131257018 15:90869728-90869750 GCCCCAGGGGAGCCCGCAGTGGG - Intronic
1131508466 15:93035936-93035958 GTCCTCACGGAGCTCACAGGAGG - Intronic
1133404841 16:5515232-5515254 GCCCACATGGAGCTGACAGTAGG - Intergenic
1133730940 16:8578006-8578028 GCCCTCATGGAGTTCACAGATGG + Intronic
1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG + Intronic
1134839764 16:17392367-17392389 GCCCTGAGGGAGGTGACATTTGG - Intronic
1136469303 16:30468381-30468403 GCCCTTTGGGAGGTCAAAGTGGG - Intergenic
1137447659 16:48541633-48541655 GCCCCCAGGCTGCTCACAGTCGG - Exonic
1138661126 16:58517720-58517742 GCACTTAGGGAGGTCAAAGTGGG - Intronic
1141540103 16:84713528-84713550 GCCCTCACGGAGCTTACATTGGG - Intronic
1141548310 16:84787059-84787081 GCCCTTAGGGAGCACCCAGGAGG + Intergenic
1142496240 17:307519-307541 GCCCTCCAGGAGCTCATAGTTGG - Intronic
1142601313 17:1054363-1054385 GCCCTCAGAGAACTCACAGTGGG + Intronic
1142960006 17:3546729-3546751 GCCCTCTGGGAGGTCAAAGTGGG + Intronic
1144020373 17:11235668-11235690 ACCCTAAAGGAGCTGACAGTTGG + Intergenic
1145784058 17:27582749-27582771 GCCCCCAGGGAGCTCCCAGCTGG + Exonic
1146348326 17:32075479-32075501 GCCCCAAGGGCGCTGAGAGTTGG - Intergenic
1146790454 17:35747832-35747854 GCCCTCAGGGGACTCACAGAGGG + Exonic
1146951340 17:36908688-36908710 GCCCTATTGGAGATTACAGTTGG + Intergenic
1147174960 17:38649641-38649663 GCACTCTGGGAGGTCACAGTGGG - Intergenic
1147658057 17:42102138-42102160 GCCCTCAGGGAGCCCTCACTAGG - Intronic
1151840603 17:76614993-76615015 GCCCTGTGGGAGCCCACCGTGGG + Intergenic
1151985188 17:77538203-77538225 GCCCTTGAGGAGCTGACAGTCGG + Intergenic
1154435365 18:14337853-14337875 GCCATGAGGGAGCTCAGAGTGGG + Intergenic
1156527196 18:37778278-37778300 GCCCTGAGGGAGCTCACTGCAGG - Intergenic
1157766028 18:50298331-50298353 GCGCTCCAGGAGCTCACAGTTGG + Intergenic
1158050948 18:53219132-53219154 GCCTTCATGCAGCTCACAGTTGG + Intronic
1158051132 18:53221487-53221509 GCCTTCATGGAGCTCACAGTTGG - Intronic
1160106696 18:75984446-75984468 GCCCTCATGGAGGTTACAGTGGG - Intergenic
1160950030 19:1661826-1661848 GCCCTTCGGGAGGTCAAAGTGGG + Intergenic
1162101708 19:8342975-8342997 GCCCTTCGGGAGCTCACTGCGGG - Intronic
1162493458 19:11009264-11009286 GCACTTTGGGAGCTCAAAGTGGG - Intronic
1165791256 19:38494055-38494077 GCCCTTTGGGAGGCCACAGTAGG + Intronic
1166354851 19:42220880-42220902 GCCCTAGGGGAGTTCTCTGTTGG + Intronic
1166998090 19:46729377-46729399 GCCCTGGAGGAGTTCACAGTGGG - Intronic
1167106741 19:47434649-47434671 GCCCACAAGGAGCTTACAGTAGG + Intronic
1167676847 19:50892639-50892661 GGCCTCAGAGAGCTCACAGCGGG - Intergenic
925439553 2:3872596-3872618 GCCCTCCGGGAGCTGACAGGAGG - Intergenic
925812332 2:7712713-7712735 GCACGAAGGGAGCACAGAGTAGG + Intergenic
926145097 2:10392285-10392307 GCCCTAAGGGAGGCCAAGGTGGG - Intronic
926199629 2:10785016-10785038 TCCCTAAGGGAGCTCTCTTTTGG - Exonic
927198520 2:20564362-20564384 GCCCTGAGGGAGCCCAGAGCTGG - Intronic
927783914 2:25959313-25959335 GCCATGAGGGAGCTCACAGGGGG - Intronic
928398871 2:30963969-30963991 GCCCTAAAGGAGCTCACTGAAGG + Intronic
929053161 2:37855048-37855070 GTCCCCAAGGAGCTCACAGTGGG - Intergenic
929114619 2:38433834-38433856 GCCCTTAGGCGGCACACAGTAGG + Intergenic
929890830 2:45917746-45917768 GCCGCACGGGAGCTCACGGTCGG + Intronic
929965280 2:46529948-46529970 GCACTCAGGGAGCTCAGGGTAGG + Intronic
932218127 2:69979747-69979769 GCACCATGGGAGCTCAGAGTTGG + Intergenic
932292780 2:70596525-70596547 GACCTGATGGAGCTAACAGTGGG - Intergenic
935411942 2:102773226-102773248 GCCCTCAGGGGGCTGACATTTGG + Intronic
937289482 2:120773638-120773660 GCCCTCAGGTAGCCCCCAGTTGG + Intronic
937576493 2:123428849-123428871 GCCCTAAAGGAGCTGATAGCAGG - Intergenic
937950753 2:127386503-127386525 GCCCAAAGGGAACTCACAGTTGG - Intronic
938060364 2:128249772-128249794 GCCCAGAGGGAGCTCAGAGTTGG + Intronic
941109688 2:161405415-161405437 GCTCTCAAGGAGCTCACATTTGG - Intronic
941934023 2:170969399-170969421 GCCCTAAGGGAGCTCACAGTAGG + Intergenic
942538341 2:176989116-176989138 GCCTTCAGGGAGCTTATAGTAGG - Intergenic
943520581 2:188944510-188944532 GCCATGCGGGAGCCCACAGTGGG + Intergenic
944350194 2:198717647-198717669 GCCATAAGGGACCACACAGGAGG + Intergenic
945833381 2:214811038-214811060 GACCTAAGGGAACGCACTGTGGG - Intergenic
946039355 2:216770589-216770611 GCCTTGAGGGAGCTCACAGTTGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
948486181 2:238282729-238282751 GCCCTCAGGGAGCTTACATTAGG + Intronic
1170693426 20:18635740-18635762 GTCCTAAGTCAGCTCATAGTGGG + Intronic
1171880449 20:30614627-30614649 GCCTGGAGGGAGCTCAGAGTGGG - Intergenic
1172124493 20:32617254-32617276 GCCCTCAGGGAGCTCATTCTAGG - Intergenic
1174484035 20:50850400-50850422 GCCCTTGGGAAGCTCACAGAGGG - Intronic
1175144439 20:56885070-56885092 GCCCTCAGGGAGCTCCCAGTTGG - Intergenic
1175569628 20:60009033-60009055 GCCCTCAGGGAGGTTACAGTCGG - Intronic
1175873014 20:62217205-62217227 ACCCCCAGGGAGCTCACAGCTGG - Intronic
1176841675 21:13847852-13847874 GCCATGAGGGAGCTCAGAGTGGG - Intergenic
1178692978 21:34765094-34765116 GCCCTCATGGAGCTTACAGTTGG + Intergenic
1179920381 21:44504128-44504150 GGCCTCAGTGAGCCCACAGTGGG + Intronic
1179920466 21:44504432-44504454 GGCCTCAGTGAGCCCACAGTGGG + Intronic
1180995498 22:19963343-19963365 GCTCCAAGCGCGCTCACAGTGGG + Intronic
1183912612 22:41091307-41091329 GCCCTACGGGCGCTCCCATTTGG + Intergenic
1184098918 22:42331334-42331356 GATCTCAGGGAGCACACAGTAGG - Intronic
1184412937 22:44336380-44336402 GCCCCAAAGAAGCTCACTGTCGG + Intergenic
1184460159 22:44633330-44633352 GACCCAGGGGAGCTCACGGTGGG - Intergenic
949934717 3:9107800-9107822 GCTCTCAAAGAGCTCACAGTAGG - Intronic
949957527 3:9281241-9281263 GCCTTCAGGAAGCTCCCAGTAGG - Intronic
950584379 3:13881882-13881904 GTCCTAAGGGAACACACTGTGGG + Intergenic
955238763 3:57162390-57162412 GCTCTAAGGTTGCTTACAGTGGG - Intronic
961578796 3:127860697-127860719 GCCCTCACAGAGCTCACAGCCGG + Intergenic
961584448 3:127910595-127910617 GTCCTCAGGGAGCTCACATTTGG + Intergenic
961627758 3:128275521-128275543 GCCCTGGGGGAGCCCTCAGTGGG + Intronic
966026263 3:175286843-175286865 GCCCTTTGGGAGGCCACAGTGGG + Intronic
968943508 4:3651789-3651811 GGGCTCAGGGAGCTCACAGTGGG + Intergenic
969254530 4:5993043-5993065 GCCCTTGGGAGGCTCACAGTCGG - Intergenic
969387981 4:6869081-6869103 CCCCTCAGGAAGCTTACAGTCGG + Intronic
969618716 4:8268369-8268391 GTCCTATGGGGGCTCACACTTGG + Intergenic
975747169 4:77485971-77485993 ACCCTGAGGGAGCTGACAGCTGG + Intergenic
976511040 4:85910254-85910276 TCCCTCAGGGAGCTCAGACTTGG - Intronic
978114394 4:105002421-105002443 ACTCTAAAGGAGCTCACAGCTGG - Intergenic
979323907 4:119356793-119356815 GCCCTGAAGGTGCTGACAGTGGG + Intergenic
981250841 4:142598768-142598790 GCACAGAGGCAGCTCACAGTGGG - Intronic
981425271 4:144595569-144595591 GCTCTAAGTAAGATCACAGTTGG + Intergenic
983241746 4:165241477-165241499 GCCCTGAAGGTGCTGACAGTGGG + Intronic
985044050 4:185922331-185922353 GCACTAAGGGAGAACACACTGGG + Intronic
987373668 5:17216492-17216514 GCCCTAAGGGGGCGGACACTTGG - Intronic
988143033 5:27267327-27267349 GCCGTAAGGGAGCCCATGGTGGG + Intergenic
990738847 5:58891842-58891864 GGCCTGAGGAAGCTCACAGATGG + Intergenic
991671648 5:69054201-69054223 GCCCTGAAGAAGCTGACAGTTGG + Intergenic
992524153 5:77590421-77590443 GCCCCAAGGGACCACACAGATGG + Intronic
997843670 5:137265860-137265882 ACCCTACAGGAGCTCAGAGTGGG - Intronic
998079255 5:139261049-139261071 GTCCTCAAGGAGCTCCCAGTTGG - Intronic
998137775 5:139683482-139683504 GCCAGCAGGGAGCTCACAGAAGG + Exonic
999838235 5:155397675-155397697 ACCCTCAGGAAGCTTACAGTTGG + Intergenic
1001244776 5:170098040-170098062 GCCCGAAGGGTGTTCAGAGTAGG + Intergenic
1005304007 6:24496251-24496273 GCCCTTATGGAGCTCACATGGGG + Intronic
1007432023 6:41782013-41782035 GCCCTCAAGGAGCTCATAGTGGG - Intronic
1007635392 6:43296953-43296975 ACCCTTAGGGAGCTTACAGGAGG - Intronic
1007791339 6:44310531-44310553 GGCCCAAGGGAGCTGACAGTGGG + Intronic
1008149510 6:47933241-47933263 GCACCTATGGAGCTCACAGTAGG - Intronic
1011832119 6:91386810-91386832 GTCCTCATGGAACTCACAGTTGG + Intergenic
1015847459 6:137535717-137535739 ACTCTAAGGAAGTTCACAGTGGG + Intergenic
1016073398 6:139768288-139768310 GCCATAGGGGAGCCCACAGTTGG - Intergenic
1017829693 6:158115264-158115286 GTCCTGAGGGAGCTCCCAGCTGG - Intronic
1019386843 7:761925-761947 GACCTAGCGGAGCTCACAGCTGG + Intronic
1019728472 7:2616610-2616632 CCCCTAGGGGAGATCACAGCTGG - Intergenic
1022705622 7:32799475-32799497 GCCCTTTGGGAGATCAAAGTGGG - Intergenic
1023921560 7:44634073-44634095 GCTCCAAGGGAGCTGGCAGTGGG - Intronic
1024078093 7:45833550-45833572 GCACTTAGGGAGGTCACAGCAGG + Intergenic
1024686036 7:51746355-51746377 CCCCAAAGGGAGCTCCCAGTTGG - Intergenic
1028924208 7:96339926-96339948 GCCCAAAGGGAACTCACTGGAGG - Intergenic
1031322177 7:120344906-120344928 ACCCTTAAGGAGCTCACAGCTGG + Intronic
1033267051 7:139895577-139895599 GCCCTGAAGGAGCTAACAGCTGG + Intronic
1036927318 8:12919693-12919715 TCCCCGAAGGAGCTCACAGTTGG + Intergenic
1040551215 8:48439039-48439061 TCCCACAGGGAGCACACAGTGGG - Intergenic
1041022321 8:53650272-53650294 GACCTCTGGTAGCTCACAGTGGG - Intergenic
1042684065 8:71418002-71418024 GCCCTAAGGCAGCTCAGAGAAGG - Intronic
1043170396 8:76958777-76958799 GCTCAGAGGGAGCACACAGTTGG + Intergenic
1044260349 8:90112735-90112757 GCCCTATGGGAGAACACAGAGGG + Intergenic
1045530815 8:102983674-102983696 GCCCTCAGTGAGTTCACATTTGG + Intergenic
1047494959 8:125402815-125402837 GCACTTTGGGAGGTCACAGTGGG + Intergenic
1048457604 8:134592157-134592179 TGCCTTGGGGAGCTCACAGTAGG - Intronic
1051778513 9:20662329-20662351 ACCCTAAAGGAGCTGACAGCTGG - Intronic
1053478794 9:38400965-38400987 TCCCTGCAGGAGCTCACAGTTGG + Intergenic
1056535707 9:87525702-87525724 GGTCTGAGAGAGCTCACAGTGGG - Intronic
1058153747 9:101488914-101488936 GCCTTTAGGGAGCTTACATTTGG + Intronic
1059565926 9:115382851-115382873 GACCTAAGGCAGATGACAGTGGG + Intronic
1060749405 9:126159130-126159152 GTCCTCAGGGAACTCACAGGAGG - Intergenic
1060800053 9:126538275-126538297 GGCCTATGGGAGCACACAGGAGG - Intergenic
1061094907 9:128450929-128450951 GCCTTAAGAGAGCACCCAGTAGG + Intergenic
1061258890 9:129468214-129468236 GCCCTCAGGGAGCTTCCTGTAGG - Intergenic
1061321862 9:129835710-129835732 GCCCCCAGGGAGCTCAGAGTGGG - Intronic
1062575061 9:137202389-137202411 GCCCTAAGGGAGGAGACACTTGG - Intronic
1190180917 X:48191502-48191524 GCCCTCAAGGAGCTCACAGTAGG + Intronic
1190183361 X:48213559-48213581 GCCCTCAAGGAGCTCACAGTAGG - Intronic
1190193958 X:48300970-48300992 GTCCTCAAGGAGCTCACAGTAGG + Intergenic
1190196410 X:48323116-48323138 GCCCTCAAGGAGCTCGCAGTAGG - Intergenic
1190199844 X:48351369-48351391 GCACTCAAGGAGCTCACAGTAGG + Intronic
1190204061 X:48388082-48388104 GCCATCAAGGAGCTCACAGTAGG - Intronic
1190206475 X:48407321-48407343 GCCATCAAGGAGCTCACAGTAGG + Intronic
1190209320 X:48432294-48432316 GCCATCAAGGAGCTCACAGTAGG - Intergenic
1190655426 X:52607898-52607920 GCCCTCAAGGAGCTCACAGTAGG + Intergenic
1190660473 X:52649629-52649651 GTCCTCAAGGAGCTCACAGTAGG + Intronic
1190663131 X:52673482-52673504 GCCCTCAAGGAGCTCACAGTAGG - Intronic
1190666622 X:52701850-52701872 GCACTCAAGGAGCTCACAGTAGG + Intronic
1190672796 X:52756558-52756580 GCACTCAAGGAGCTCACAGTAGG - Intronic
1190676292 X:52785000-52785022 GCCCTCAAGGAGCTCACAGTAGG + Intronic
1190948094 X:55115437-55115459 GACCTCAAAGAGCTCACAGTTGG + Intronic
1193781024 X:85701493-85701515 GCCTTAAAGGGACTCACAGTTGG - Intergenic
1194571626 X:95560360-95560382 GCCCAAAGGGAGATCTCAGAGGG + Intergenic
1194884495 X:99296181-99296203 GCCTTAAGGTATCTCAGAGTGGG - Intergenic
1195880264 X:109586147-109586169 GCTCTCAGGAAACTCACAGTGGG + Intergenic
1198782471 X:140252353-140252375 GCCCTCTGGGAGCTCACAGTGGG + Intergenic
1199765165 X:150936048-150936070 GCCCTCAGGGAGCTCCCAGTCGG - Intergenic
1199889049 X:152056821-152056843 GCACTAAGGGAGGTCAAGGTGGG - Intergenic
1200149977 X:153946599-153946621 GCTCCAAGGCAGGTCACAGTTGG + Intergenic
1200232017 X:154448838-154448860 GCCCCAAGGCTGCTCTCAGTGGG + Intronic
1200650149 Y:5831368-5831390 GTCCTAATGGAGGTTACAGTTGG + Intergenic
1200925058 Y:8646897-8646919 GCCCTAAGGGAACTGGCACTTGG + Intergenic
1201420337 Y:13791632-13791654 GCACTTTGGGAGGTCACAGTGGG - Intergenic