ID: 941948504

View in Genome Browser
Species Human (GRCh38)
Location 2:171127741-171127763
Sequence GAGAGGTATTTTAAATTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941948504_941948508 3 Left 941948504 2:171127741-171127763 CCCACTAATTTAAAATACCTCTC No data
Right 941948508 2:171127767-171127789 TTATCACATTCCATAAACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941948504 Original CRISPR GAGAGGTATTTTAAATTAGT GGG (reversed) Intronic
No off target data available for this crispr