ID: 941951501

View in Genome Browser
Species Human (GRCh38)
Location 2:171160847-171160869
Sequence CGGCGGCGGGCTGTGGGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 678}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941951490_941951501 -1 Left 941951490 2:171160825-171160847 CCCGGCGTCGCCCGGGAGGCGGC 0: 1
1: 0
2: 0
3: 19
4: 147
Right 941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG 0: 1
1: 0
2: 5
3: 75
4: 678
941951487_941951501 1 Left 941951487 2:171160823-171160845 CCCCCGGCGTCGCCCGGGAGGCG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG 0: 1
1: 0
2: 5
3: 75
4: 678
941951480_941951501 24 Left 941951480 2:171160800-171160822 CCGGCACCTCTGCAGTGCGTCGG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG 0: 1
1: 0
2: 5
3: 75
4: 678
941951491_941951501 -2 Left 941951491 2:171160826-171160848 CCGGCGTCGCCCGGGAGGCGGCG 0: 1
1: 0
2: 1
3: 25
4: 184
Right 941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG 0: 1
1: 0
2: 5
3: 75
4: 678
941951479_941951501 28 Left 941951479 2:171160796-171160818 CCTGCCGGCACCTCTGCAGTGCG 0: 1
1: 0
2: 1
3: 16
4: 117
Right 941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG 0: 1
1: 0
2: 5
3: 75
4: 678
941951488_941951501 0 Left 941951488 2:171160824-171160846 CCCCGGCGTCGCCCGGGAGGCGG 0: 1
1: 0
2: 1
3: 18
4: 119
Right 941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG 0: 1
1: 0
2: 5
3: 75
4: 678
941951482_941951501 18 Left 941951482 2:171160806-171160828 CCTCTGCAGTGCGTCGGCCCCCG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG 0: 1
1: 0
2: 5
3: 75
4: 678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941951501 Original CRISPR CGGCGGCGGGCTGTGGGTGG CGG Intronic
900000284 1:11052-11074 CGGCGCCGGGCTGGGGCGGGGGG + Intergenic
900019989 1:181566-181588 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
900023300 1:199904-199926 CGCGGGCGGACTGTGGGCGGCGG - Intergenic
900113891 1:1020567-1020589 CGGCGGCGGGCGGAGGACGGCGG - Intronic
900178036 1:1299306-1299328 CCTGGGCGGGCTGTGGGTCGGGG - Intronic
900502332 1:3012599-3012621 AGGCGGCGGGGTGGGGGCGGTGG - Intergenic
900645252 1:3706111-3706133 CGGAGGCGGGCCGGGGGCGGGGG - Intronic
900901353 1:5518633-5518655 GGGGGGGGGGCTGTGGGGGGAGG - Intergenic
901086532 1:6614702-6614724 CGCCGGGGGGCGGTGGGTGGGGG - Intronic
901109908 1:6785805-6785827 CGGGGGCGGGCTGGGGCCGGAGG + Intronic
901231051 1:7641947-7641969 AGGCCGGGGGCTGCGGGTGGGGG - Intronic
901624850 1:10618083-10618105 TGACTGCAGGCTGTGGGTGGAGG - Intronic
901630285 1:10644665-10644687 GGGCGGCTGTCTGGGGGTGGAGG + Intronic
901843244 1:11966491-11966513 GGGCGGCGGGATGGGAGTGGGGG + Intronic
902238654 1:15073994-15074016 AGGCGCTGGGCTGGGGGTGGTGG - Intronic
902429543 1:16352418-16352440 CGGCGGCGGCGTTTGAGTGGAGG - Exonic
902562189 1:17284496-17284518 AGGGGCCGGGCTGTGGCTGGAGG + Intergenic
902691189 1:18110823-18110845 TGGCGCCGGGCTGGGGATGGAGG + Intronic
902697769 1:18151721-18151743 CTGCAGGGGGCTGTGGGGGGCGG + Intronic
902916839 1:19644553-19644575 CGGCCGCGGGCACCGGGTGGAGG + Intronic
903055538 1:20633655-20633677 CGGCGGCGGGCTGTGTCCGCGGG + Exonic
903210289 1:21814498-21814520 CGACTGCGGGCTCTGGGTGCAGG + Exonic
903986966 1:27235144-27235166 CGGGGGCGGGGTGGGGGCGGAGG + Intronic
904205980 1:28855531-28855553 CGGGGCGTGGCTGTGGGTGGAGG + Intronic
904573235 1:31483766-31483788 AGGGGGTTGGCTGTGGGTGGTGG + Intergenic
904762899 1:32818016-32818038 CGGCGGGAGGCTGTTGCTGGCGG + Exonic
905038059 1:34929989-34930011 CGGCGGCGGGCGGGCGGTCGGGG + Intergenic
905153100 1:35948462-35948484 CGGCGGTGGGGTGGGGGCGGGGG - Intronic
905190310 1:36228640-36228662 CTGCTGCAGGCTGTGCGTGGTGG - Intronic
905741228 1:40373574-40373596 GGGGGGCGGGCCTTGGGTGGGGG - Intronic
905743162 1:40389903-40389925 CGGGGGAGGGGAGTGGGTGGAGG - Intronic
905789837 1:40784068-40784090 CGGCGCCGGGCTGGGGGCGCCGG - Exonic
906083123 1:43107487-43107509 GGGCGGGGGGCAGGGGGTGGTGG + Intergenic
906130752 1:43453834-43453856 AGGCGGCGGGCGGCGGGCGGCGG + Exonic
906130755 1:43453841-43453863 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
906130760 1:43453848-43453870 GGGCGGCGGGCGGCGGGCGGGGG + Exonic
907414079 1:54302037-54302059 GGGCGGCTGGGTGGGGGTGGGGG + Intronic
908473984 1:64470718-64470740 CGTCGGCGGGGAGTGGGGGGAGG + Intergenic
910827789 1:91428066-91428088 CGGCGGAGGGGTGGGGGCGGTGG - Intergenic
912576202 1:110674754-110674776 CGGTGGCGGGCTGAGGGCGGCGG + Exonic
912954305 1:114143807-114143829 CAGGGGTGGGCTGGGGGTGGGGG - Intronic
913939237 1:125086694-125086716 CGGCGGCGGCAGGGGGGTGGGGG + Intergenic
915322370 1:155062860-155062882 CGAGGGCGGGCTGTGTGGGGCGG + Intergenic
915367329 1:155323526-155323548 CGGCGCCGGGCTGCGGCTGCTGG + Intronic
915519918 1:156436173-156436195 CGGCGGCGGGCAGCGCGCGGAGG - Intergenic
915557498 1:156668678-156668700 CGGGGGCGGGCGGGGGGTGGCGG - Intergenic
915972925 1:160366888-160366910 CGGGGGCTGGCCCTGGGTGGGGG - Intergenic
916107489 1:161442036-161442058 AGGCGGTGGGCGGTGGGCGGAGG - Intergenic
916110661 1:161456835-161456857 AGGCGGTGGGCGGTGGGCGGAGG - Intergenic
916890253 1:169106606-169106628 CGGCGGCGGGGCGGGGGCGGAGG - Exonic
918018313 1:180659590-180659612 CGGCGGGGGGTGGGGGGTGGGGG - Intronic
918093659 1:181317611-181317633 GGGCGGCGGGCGGGGGGAGGGGG - Intergenic
920500093 1:206480291-206480313 GGGAGGCGGGCTGTAGGTGGAGG + Intronic
921389297 1:214603355-214603377 TGGCGGCGGGCGGTAGGCGGCGG + Intronic
921472667 1:215567559-215567581 CGGCGGCGGCCGGAGGGCGGGGG - Exonic
922958529 1:229625751-229625773 CGCCGGCGGGCGGTGGGGGTGGG - Intronic
923230670 1:231983527-231983549 CGGGGGTGGGGTGGGGGTGGGGG + Intronic
923744340 1:236686575-236686597 AGGCGGCGGGCGGCGGGCGGCGG - Exonic
924172526 1:241357060-241357082 CGGCGGCGAGGCGAGGGTGGCGG - Exonic
924436846 1:244049351-244049373 GGGCGGCGGGCTGGGGGAGGGGG + Intronic
1062774649 10:135356-135378 CGGCGGCGGGGTCCGGGCGGGGG + Intronic
1063443145 10:6089387-6089409 CGGCGGCGGGCGGAGGGTACCGG - Exonic
1064074950 10:12261295-12261317 CGGAGGTGGGATGTGGCTGGCGG - Intergenic
1064231800 10:13535848-13535870 GGGCGGCGGGGGGAGGGTGGGGG - Intergenic
1065034247 10:21621604-21621626 CGGGGGCGGGGTGGGGGGGGCGG - Intronic
1067145159 10:43689126-43689148 CGGGGGCGGGGTGTCGGAGGCGG + Intergenic
1067250130 10:44578963-44578985 CGGGGCCTGTCTGTGGGTGGGGG - Intergenic
1067824151 10:49557615-49557637 ATGAGGTGGGCTGTGGGTGGGGG - Intergenic
1067928639 10:50537603-50537625 TGGGGGCGGGCAGGGGGTGGCGG - Intronic
1069699602 10:70412388-70412410 CGGCCGGGGGGTGGGGGTGGGGG + Intronic
1069800043 10:71076359-71076381 CGACGGAGGGCTGTGGCTGCAGG + Intergenic
1069925934 10:71850994-71851016 CGGCTGGGGGCTGCGGGGGGCGG - Intronic
1070279982 10:75041518-75041540 CAGCGGAGGGGTGTGGGTAGGGG - Intronic
1070800666 10:79242978-79243000 GGGCGGCGGGCTGGGGGGCGGGG + Intronic
1071574397 10:86715174-86715196 CAGAGGCGGGGTGTGGGTGCAGG + Intronic
1072670480 10:97425903-97425925 GGGCGGCGGGCGGCGGGTTGTGG - Intronic
1072670482 10:97425910-97425932 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
1073043314 10:100621790-100621812 GGGTGGGGGGCTGCGGGTGGGGG + Intergenic
1073050070 10:100661539-100661561 CGGGGGTGGGGTGGGGGTGGGGG + Intergenic
1073520221 10:104121689-104121711 AGGCGGCGGGCTGGCGGGGGTGG + Intergenic
1073577405 10:104638456-104638478 AGGCAGGGGGCTGGGGGTGGGGG + Intergenic
1074560928 10:114534492-114534514 CTGAGGCGGGGTGGGGGTGGGGG + Intronic
1074776373 10:116770939-116770961 CTGCTGCGGGCTGTGTGTGCTGG + Intergenic
1075679338 10:124321386-124321408 GGGCGGAGGGGTGGGGGTGGTGG - Intergenic
1076064786 10:127440557-127440579 CGTCGGCGGGCTGTGATTAGAGG + Intronic
1076571633 10:131437216-131437238 GGGCTGTGGGCAGTGGGTGGAGG - Intergenic
1076888881 10:133274479-133274501 GGGCGGAGGGCAGAGGGTGGGGG + Intronic
1076963484 10:133786326-133786348 CGTCGCTGGGCTGAGGGTGGCGG - Intergenic
1077117034 11:889871-889893 GGGAGGGGAGCTGTGGGTGGAGG - Intronic
1077224939 11:1435582-1435604 CGGAGGAGGGGTGTCGGTGGGGG + Intronic
1077445324 11:2588039-2588061 GGGCCGCGCGCAGTGGGTGGTGG + Intronic
1077551956 11:3204388-3204410 CGGAGGCTGCCCGTGGGTGGGGG + Intergenic
1077865385 11:6217715-6217737 AGGGGGCGGGCTGGGGGTGCAGG - Exonic
1078415134 11:11158381-11158403 TGGGGGCGGGCGGTGGGGGGGGG + Intergenic
1078856680 11:15210967-15210989 CGGCAGCAGGTTGTGGGTGATGG - Intronic
1079882510 11:25944654-25944676 CTGGGGCGGGGTGTGGGGGGTGG - Intergenic
1081739827 11:45430951-45430973 GGGCGGGGGGCGGTGGGAGGAGG + Intergenic
1081831605 11:46120390-46120412 CGGCCGGGGGCTGCGGGCGGGGG - Intronic
1083595938 11:63918297-63918319 CGGCCGCAGGCAGCGGGTGGGGG - Intergenic
1083623723 11:64061329-64061351 AGGCTGCGGGCTGGGGGCGGAGG - Intronic
1083629704 11:64089234-64089256 GGGCCCCGGGCTCTGGGTGGGGG + Intronic
1083683454 11:64361794-64361816 CTGGGCAGGGCTGTGGGTGGGGG + Intronic
1083684721 11:64369367-64369389 CGGGGGCGGGGCCTGGGTGGTGG + Intronic
1083753866 11:64778567-64778589 CGGGGGCGGGCCGGGGGCGGCGG + Intronic
1083759895 11:64810109-64810131 TGGCGGCGGGCGGTGGGCGGCGG + Exonic
1083890107 11:65591772-65591794 AGGTGGCGGGGGGTGGGTGGCGG - Intronic
1084010870 11:66347684-66347706 GGGCGGCGGGCGGCGGGCGGCGG - Exonic
1084010873 11:66347691-66347713 GGGCGGCGGGCGGCGGGCGGCGG - Exonic
1084010876 11:66347698-66347720 CGGTGGCGGGCGGCGGGCGGCGG - Intergenic
1084295901 11:68213367-68213389 CGGCGGCCGGTTGGGGGCGGGGG - Exonic
1084295904 11:68213370-68213392 CGGCGGCGGCCGGTTGGGGGCGG - Exonic
1084412809 11:69013928-69013950 TGGAGGCGGGCGGTGGGGGGGGG + Intergenic
1084742939 11:71150764-71150786 CGGCTGCGTGGAGTGGGTGGGGG + Intronic
1084864042 11:72041319-72041341 GGGCGGCGGGTTGAGGGTGAAGG + Intronic
1084934001 11:72577332-72577354 CAGTGGAGGGCTGTGGGAGGTGG + Exonic
1085037437 11:73308710-73308732 CGGCCCCGGGCTGAGGGAGGAGG + Exonic
1085478989 11:76806285-76806307 CTGCGGCGGGCTGAGTGAGGCGG - Intergenic
1086487684 11:87326127-87326149 AGGCAGCAGGCTGGGGGTGGGGG - Intergenic
1087124264 11:94607609-94607631 CGGAGGCGAGCTGTGGGCTGTGG + Exonic
1088678818 11:112221994-112222016 AGGCTGGGGGCTGGGGGTGGGGG - Intronic
1088679433 11:112226547-112226569 CAGCGGCGGGCGGTGGGCGCCGG + Intronic
1088822330 11:113467046-113467068 CGGGGGCAGGCGGTGGGAGGCGG + Intronic
1089564070 11:119361611-119361633 GGGGGGAGGGGTGTGGGTGGGGG + Intronic
1090699174 11:129279227-129279249 CGGCGGCGGGCGGAGGGCGTCGG - Intronic
1091373369 12:11180-11202 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
1091376999 12:31442-31464 CGCGGGCGGACTGTGGGCGGCGG - Intergenic
1091460812 12:642661-642683 GGGGGGCGGGCTGGGAGTGGGGG + Intronic
1091567899 12:1661872-1661894 CGGCGGGGGGCGGGGGGCGGGGG + Intergenic
1091571560 12:1691198-1691220 CGGCGACGGGCTCCGGGTGAGGG + Intronic
1092181797 12:6451427-6451449 GGTCGGCGGGGTGGGGGTGGAGG - Exonic
1092218391 12:6697673-6697695 GGGGGGCGGGCTGGGGCTGGTGG + Exonic
1092539799 12:9413641-9413663 GGGCGGGGGGCGGGGGGTGGGGG + Intergenic
1095206157 12:39442882-39442904 GGGCGGCGGGCGGCGGGTTGAGG - Intronic
1095206159 12:39442889-39442911 CGGCGGCGGGCGGCGGGCGGCGG - Intronic
1095826241 12:46532320-46532342 TGGGGGCGGGGTGTGTGTGGTGG + Intergenic
1096513728 12:52145450-52145472 CTGGGGCCGGCAGTGGGTGGGGG - Intergenic
1096578402 12:52569255-52569277 GGGCGGGGGGGTGGGGGTGGGGG - Intronic
1096660821 12:53123001-53123023 GGGCGGGGGGCTGGAGGTGGGGG + Intronic
1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG + Intronic
1097208199 12:57342291-57342313 CGGGAGAGGGCTGTGGGTGGGGG - Intronic
1097265178 12:57740202-57740224 TGGTGGGGGGCTGAGGGTGGGGG + Intronic
1097288682 12:57896563-57896585 CGGCGGCGGGCTCTGGGGCGCGG - Intergenic
1097990087 12:65824998-65825020 CGGCGGCGGTGGGTGGGTGCCGG - Exonic
1098254799 12:68606091-68606113 CGGCGGCGGGGGGGGGGGGGAGG + Intergenic
1098312108 12:69158762-69158784 GGGCGGCGGGGTGGGGGCGGCGG - Intergenic
1098963629 12:76763985-76764007 CGGCGGAGGGCTCTGGGCGTGGG - Exonic
1099665250 12:85619966-85619988 GGCCGGGGGGCTGGGGGTGGTGG + Intergenic
1100468826 12:94873132-94873154 CGTCGGCGGGCCGTGCCTGGAGG + Intergenic
1102035377 12:109768199-109768221 CAGCGGTGTGCTGTGGGTAGGGG - Exonic
1102116005 12:110403464-110403486 CGGCGGCGGTCTGGGAGCGGGGG - Intronic
1102197407 12:111034848-111034870 CGGCGGCGGCCCCCGGGTGGCGG - Intronic
1102948492 12:117011233-117011255 CGGCCCCGGGCTGCAGGTGGCGG + Intronic
1103497579 12:121374701-121374723 GGGCGGGGGGCAGGGGGTGGGGG - Intronic
1103610834 12:122123276-122123298 TGGGGGCGGGCTGGGGGTGCAGG + Intronic
1103610972 12:122124156-122124178 CGGGGGACGGCTGAGGGTGGGGG - Intronic
1103698545 12:122835650-122835672 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1103698548 12:122835657-122835679 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1103927673 12:124432856-124432878 CGGCGGGGGGCGGGGGGTGGGGG + Intronic
1104023292 12:125008236-125008258 AGGCGGCGGGATCTGGGAGGAGG - Intronic
1104069369 12:125331078-125331100 CGGCGGCGGCCACTGGGTGGCGG + Intronic
1104643521 12:130481944-130481966 TGGTGGTGGGCGGTGGGTGGTGG - Intronic
1104849083 12:131862689-131862711 TGGCGGGGGGCTGTGTGTGCGGG - Intergenic
1104963686 12:132499688-132499710 CAGCTGGGGGCTGTGGCTGGGGG + Intronic
1105514249 13:21076156-21076178 AGGCGGAGGGGTGAGGGTGGAGG - Intergenic
1107853209 13:44591253-44591275 GGGTGGCGGGCTGGGGCTGGGGG - Intergenic
1108221012 13:48233311-48233333 CGGCGGCGGGCTCGGGGCGCGGG - Exonic
1108403991 13:50081639-50081661 CGGCGGCGGGCGGAATGTGGCGG - Intergenic
1113481772 13:110626549-110626571 CGGAGGGGGGCTGGGGTTGGGGG + Intronic
1113534257 13:111051811-111051833 CTGCGGCGGGCTGAGGGGGCTGG - Intergenic
1113767416 13:112889841-112889863 CGGCGGTGGGGTGGGGTTGGAGG + Intergenic
1113975902 13:114227013-114227035 CGGCGGGGGAGTGTGGGGGGCGG + Intergenic
1113989919 13:114353167-114353189 CGTCGCTGGGCTGAGGGTGGCGG - Intergenic
1114270569 14:21098107-21098129 GGGGGGCGGGGTGGGGGTGGCGG - Intronic
1114626834 14:24135928-24135950 AGGCGGCGGGCGGCAGGTGGCGG + Intergenic
1114756633 14:25267351-25267373 CGGTGGCGGGATGTAGGTGCTGG + Intergenic
1115398513 14:32934634-32934656 GCGCAGCGGGCTGGGGGTGGGGG - Intergenic
1115754902 14:36520362-36520384 CGGGGGCGGGTTGTGGCTCGGGG - Intronic
1115985814 14:39102994-39103016 CGGGGGCGGGCTGGCGGCGGCGG - Intronic
1116871483 14:50072829-50072851 GGGCGGAGGGCGGTGGGGGGGGG + Intergenic
1117941595 14:60972478-60972500 CGGCGGCGGGATGTGGGCACCGG + Exonic
1118410341 14:65470873-65470895 GGGCGGCGGGCTGTTGAGGGAGG + Intronic
1118932383 14:70254949-70254971 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932386 14:70254956-70254978 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932389 14:70254963-70254985 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932392 14:70254970-70254992 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932395 14:70254977-70254999 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932398 14:70254984-70255006 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932401 14:70254991-70255013 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932404 14:70254998-70255020 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932453 14:70255111-70255133 CAGCAGTGGGCTGGGGGTGGCGG - Intergenic
1119003902 14:70907520-70907542 CGCTGGCGGGCCGCGGGTGGCGG + Exonic
1119419766 14:74501579-74501601 CGGCTGGGGGCTCTGGGAGGAGG + Exonic
1119732687 14:76961092-76961114 CGGCAGTGGGGTGGGGGTGGGGG + Intergenic
1119898704 14:78242518-78242540 CAGCGGCAGGCTGTGGGGAGGGG - Intronic
1120132338 14:80822499-80822521 TGGCGGCAGGATGTAGGTGGTGG - Intronic
1120545676 14:85808716-85808738 CGGCGGCGGGCGGGGGGGTGGGG + Intergenic
1120751510 14:88202784-88202806 CGGTTGCGGGGGGTGGGTGGTGG + Intronic
1120765446 14:88323572-88323594 CGGCGGGAGGCGGTGGGCGGTGG + Intronic
1120881294 14:89417004-89417026 GGGCGGCGGGCGGCGGGGGGCGG + Intronic
1120953049 14:90060503-90060525 CGGGGGCGGGATGTGTCTGGAGG + Intergenic
1121319992 14:92986669-92986691 GGTTGGTGGGCTGTGGGTGGAGG + Intronic
1121796462 14:96740389-96740411 GGGCGGGGGGCGGTGGGGGGGGG - Intergenic
1122051938 14:99066590-99066612 CGGCGGAGGGCGGTGGAGGGCGG + Intergenic
1122144160 14:99679251-99679273 CAGCGGCCAGCTGTAGGTGGTGG - Exonic
1122299115 14:100722092-100722114 CGGCAGGGTGCTGTGGGTGGGGG - Intergenic
1122348267 14:101073584-101073606 CTGCTGAGGGCTGTGTGTGGGGG + Intergenic
1122543374 14:102509719-102509741 CGGCGGCGGGCGGCGGGCGGCGG + Exonic
1122543377 14:102509726-102509748 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
1122606060 14:102948248-102948270 CGGGGGTGGGGTGGGGGTGGAGG + Intronic
1122645257 14:103189562-103189584 CGGCGACGGGATGCTGGTGGGGG - Intergenic
1122775753 14:104116433-104116455 CGGGGCTGGGCTGTGAGTGGGGG + Intergenic
1122959608 14:105088348-105088370 GGGCGGAGGGCTGGGGGCGGGGG + Intergenic
1123047958 14:105527577-105527599 GGGCGGCGGGTGCTGGGTGGGGG + Intronic
1123051917 14:105548110-105548132 CGGCGGGTGGCGGTGGGGGGCGG - Intergenic
1123057310 14:105577499-105577521 CGGGGCCTGTCTGTGGGTGGGGG - Intergenic
1123057855 14:105580352-105580374 CGGGGCCTGTCTGTGGGTGGGGG - Intergenic
1123080503 14:105691575-105691597 CGGGGCCTGTCTGTGGGTGGGGG + Intergenic
1123082138 14:105700285-105700307 CGGGGCCTGTCTGTGGGTGGGGG - Intergenic
1123224060 14:106883597-106883619 CGTCGCTGGGCTGAGGGTGGCGG - Intergenic
1123689298 15:22823623-22823645 CGGTGGCGGGTGGCGGGTGGGGG + Intronic
1124440920 15:29685743-29685765 CGGGGCCAGGGTGTGGGTGGGGG - Intergenic
1124709944 15:31999755-31999777 CGGCGCCTGTCAGTGGGTGGGGG + Intergenic
1124971480 15:34494370-34494392 CGGCCCCGGGAGGTGGGTGGCGG - Intergenic
1125200005 15:37095171-37095193 TGAGGGCGGGCTGGGGGTGGGGG - Intronic
1125312890 15:38399884-38399906 CTGGGGCGGGGTGGGGGTGGCGG - Intergenic
1125313038 15:38401412-38401434 CGGCGGAGGGCTGTGTGGAGAGG + Intergenic
1127868292 15:63048851-63048873 TGGCGGCGGGCTCTGGGGAGGGG + Intronic
1128078175 15:64841405-64841427 CGACGCCGGGCAGTGGGCGGTGG - Intergenic
1128273841 15:66335681-66335703 TGGCGGGGGACTGTGGGTAGGGG + Intergenic
1128741771 15:70088885-70088907 CTGCCGCGGGGTGGGGGTGGGGG - Intronic
1129468502 15:75737695-75737717 CGGGGGCGGGGTGGGGGTGGAGG + Intergenic
1129814651 15:78540764-78540786 AGGGGGCGGGCTGAGGGTGGGGG + Intronic
1129904813 15:79179047-79179069 CACCGGCGGGGAGTGGGTGGTGG + Intergenic
1129946511 15:79543301-79543323 CAGCAGGGGGCTGTGGGTGGAGG - Intergenic
1130389955 15:83446907-83446929 AGGAAGCGGTCTGTGGGTGGCGG - Intergenic
1130519861 15:84654160-84654182 GGGCGGATGGGTGTGGGTGGAGG - Intronic
1130911422 15:88273619-88273641 CGGGGGCGGGGGGTGGGGGGGGG - Intergenic
1131136202 15:89937970-89937992 CGGGGGGGGGGTGTGGGGGGGGG - Intergenic
1132449921 15:101961552-101961574 CGCGGGCGGACTGTGGGCGGCGG + Intergenic
1132453223 15:101979893-101979915 CGGCGCCGGGCTGGGGCGGGGGG - Intergenic
1132453668 16:10731-10753 CGGCGCCGGCCTGGGGGCGGGGG + Intergenic
1132513060 16:353441-353463 CGGCGGCGGGCAGGCCGTGGCGG - Intergenic
1132585808 16:705415-705437 AGGGGGCGGGGTGGGGGTGGGGG - Intronic
1132604571 16:788408-788430 CGGGGGCGGGCCGGGGGGGGGGG - Intergenic
1132657345 16:1046804-1046826 AGCCGGCGGGCAGCGGGTGGCGG + Intergenic
1132683813 16:1154051-1154073 CGGCGGGGGGCGGGGGGCGGGGG + Intronic
1132687699 16:1169156-1169178 CTGCGGCGGGGTGGGGGTGGGGG + Intronic
1132756018 16:1485875-1485897 CGGTGGCGGAATGTGGATGGGGG + Intronic
1132764221 16:1526287-1526309 GGGAGGGGGGCTGTGGGAGGTGG - Intronic
1132789592 16:1678282-1678304 GCGCGGCGAGCTGAGGGTGGCGG + Exonic
1132807783 16:1783025-1783047 AGGCGGCGGCCGGTGAGTGGCGG + Exonic
1132975059 16:2706885-2706907 GGGCGTCGGGGTGGGGGTGGGGG + Intronic
1133097709 16:3458369-3458391 CGGCGGCGGGGAGTGGGCGCTGG + Intronic
1133188368 16:4116067-4116089 CGGCGGCGGGCGCTGGGGGTGGG + Exonic
1133597198 16:7304155-7304177 CGGCGGGGTGCGGTGGGGGGAGG + Intronic
1134134302 16:11669052-11669074 CGGAGGCGGGGTGTGGGACGGGG - Intronic
1134656124 16:15949665-15949687 CGGCGGCGGGCACCGGGCGGCGG - Exonic
1134656142 16:15949715-15949737 CGGCGGCGGGCACCGGGCGGCGG - Exonic
1134673677 16:16074449-16074471 AGGTGGCCGGCGGTGGGTGGGGG + Intronic
1136453986 16:30370193-30370215 CGGCGGGGGGATGTGAGGGGCGG - Exonic
1136497897 16:30655048-30655070 CGGCGGCACACTGTGGGTGGTGG + Exonic
1136683401 16:31980850-31980872 GGGTGCCGGGCTGTGGCTGGGGG + Intergenic
1136778869 16:32885190-32885212 CGGCGGCCTGCTGGGGGAGGGGG + Intergenic
1136784032 16:32924406-32924428 GGGTGCCGGGCTGTGGCTGGGGG + Intergenic
1136885750 16:33929400-33929422 GGGTGCCGGGCTGTGGCTGGGGG - Intergenic
1136891749 16:33976328-33976350 CGGCGGCCTGCTGGGGGAGGGGG - Intergenic
1137675257 16:50300909-50300931 CTGGGGCTGGCTGTGGATGGAGG + Intronic
1138535596 16:57658628-57658650 CGGCGGAAGGCTGGGGGTGGAGG + Intronic
1138552516 16:57755265-57755287 GGGTGGAGGTCTGTGGGTGGAGG + Intronic
1138607791 16:58099856-58099878 GGGCTTGGGGCTGTGGGTGGGGG - Intergenic
1138649304 16:58449856-58449878 AGGCAGCGGTGTGTGGGTGGGGG + Intergenic
1138691260 16:58770899-58770921 AGGCAGAGGGATGTGGGTGGAGG - Intergenic
1139504506 16:67392312-67392334 CAGCGGAGGGCTGTGGGTGTGGG - Intronic
1139594834 16:67951513-67951535 CAGTGGCGGGCTCTGGGTGACGG - Intronic
1140046266 16:71442083-71442105 CGGTGGCTGGCAGGGGGTGGGGG + Intergenic
1140927566 16:79599146-79599168 CGGCGGCGTGGTGCGGGTGCAGG + Exonic
1140927638 16:79599335-79599357 CGGCGGCGTGGTGGTGGTGGTGG + Exonic
1140949889 16:79806827-79806849 CGGGGGCGGGGTGGGGGGGGGGG + Intergenic
1141054595 16:80803956-80803978 AGGCGGCGGGCGGCGGGCGGCGG + Intronic
1141054607 16:80803999-80804021 CGGCGGCGGCCGGAGGGTGGCGG - Intronic
1141185173 16:81781868-81781890 CGGGGGCGGGCGGGGGGGGGGGG - Intronic
1141640757 16:85339636-85339658 AGGCGGCGGGCGCAGGGTGGGGG + Intergenic
1141683356 16:85556575-85556597 CGGCGGCGCGATGGGGGCGGCGG - Intergenic
1141735333 16:85848407-85848429 AGACGGCGGGCTGTGTGTAGGGG - Intergenic
1141830703 16:86508733-86508755 CGGGTGCGGGCTGGGGGCGGTGG - Intergenic
1141876292 16:86826979-86827001 CGGCGGCCGCCTTTGGGTGCTGG - Intergenic
1142161643 16:88560840-88560862 CGGGGTCGGGCTGGAGGTGGGGG - Intergenic
1142179130 16:88658798-88658820 CGGATGGGGGCCGTGGGTGGGGG - Intronic
1142234370 16:88914968-88914990 CCGGGGCGGGGTGGGGGTGGGGG + Intronic
1142267419 16:89070936-89070958 CGGCGGGGGGGTGAGGGCGGCGG - Intergenic
1142267429 16:89070956-89070978 CGGCGGAGGGTTGAGGGCGGCGG - Intergenic
1142267436 16:89070976-89070998 CGGCGGGGGGGTGAGGGCGGCGG - Intergenic
1203081283 16_KI270728v1_random:1147279-1147301 CGGCGGCCTGCTGGGGGAGGGGG + Intergenic
1203086687 16_KI270728v1_random:1188408-1188430 GGGTGCCGGGCTGTGGCTGGGGG + Intergenic
1142610973 17:1109116-1109138 CGGCGGCGGGAGGAGGGAGGAGG + Intronic
1142665767 17:1462914-1462936 GGGCGGCGCGCTGTGGGTGGAGG - Intronic
1143033762 17:3982681-3982703 TGCTGGCGGCCTGTGGGTGGAGG - Intergenic
1143590698 17:7884758-7884780 GGCGGGCGGGCGGTGGGTGGGGG + Intronic
1144842203 17:18194145-18194167 GGGCGGGGGGCAGGGGGTGGGGG + Intronic
1145693116 17:26765878-26765900 CGGCAGCGGGGTGGGGGGGGGGG - Intergenic
1145816439 17:27798362-27798384 TGGCGGAGGGGTGGGGGTGGAGG - Intronic
1145950360 17:28812417-28812439 CGGCAGCCGGCTGGGGGAGGGGG - Intronic
1146009213 17:29180275-29180297 CGGCGGCGGCCGCTCGGTGGCGG - Intronic
1146034088 17:29390826-29390848 CGGCGGCGGGGGGTGGGGGGGGG - Exonic
1146143515 17:30389139-30389161 GGGCAGCGGGCTCTGGGGGGTGG + Intronic
1146143523 17:30389159-30389181 TGGCAGCGGGCTGTGGGGGGTGG + Intronic
1146271274 17:31487625-31487647 CGGCGGCGGACCGTGTGGGGCGG + Intronic
1146521798 17:33531304-33531326 GGGCAGGGGGCAGTGGGTGGGGG + Intronic
1146956715 17:36940267-36940289 CTGCGGGGGGGTGGGGGTGGGGG - Intronic
1147264284 17:39225553-39225575 CGCGGGCAGGCTGCGGGTGGCGG + Exonic
1147605234 17:41770626-41770648 AGGGGGTGGGCTGTGGGTGCTGG - Intronic
1147909576 17:43847383-43847405 GCGGGGCGGGCTGGGGGTGGGGG + Intronic
1148115258 17:45171605-45171627 CGGGGGAGGGGTGTGGGTGAGGG + Intergenic
1148578136 17:48725530-48725552 CGGTGGCGAGCAGTTGGTGGTGG - Exonic
1148793193 17:50184993-50185015 CAGGAGCGGGCTGAGGGTGGGGG + Exonic
1149450742 17:56748216-56748238 CGGTGTGGGGCTGGGGGTGGGGG - Intergenic
1151145043 17:72032544-72032566 CGGCGGGGGGCTGTAGGTCGGGG + Intergenic
1151660676 17:75516512-75516534 CGGCGGTGGGCGGGGCGTGGCGG + Exonic
1151720851 17:75855162-75855184 GGGCGGTGGGTGGTGGGTGGTGG - Intronic
1151976725 17:77487647-77487669 CAGGGGCGGGCTGGGGGTGCAGG + Intronic
1152070451 17:78131542-78131564 GGGCGCCGGGCTGCCGGTGGGGG - Exonic
1152108103 17:78342304-78342326 CGGCGGCGGGCGGGAGGTGCTGG + Intergenic
1152197281 17:78925147-78925169 CGGCGGCGGGCTGGGGGCGCGGG + Exonic
1152407844 17:80107726-80107748 CAGCGGCGGGCGGCGGGCGGGGG + Intergenic
1152637786 17:81437249-81437271 GAGCGGCTGGCTGTGGTTGGGGG - Intronic
1152716369 17:81902559-81902581 CGGCGGCAGGACGTGGGTGGGGG + Intronic
1152744179 17:82031588-82031610 CGGCGGGGGGCGGGGGGCGGGGG - Intergenic
1152864039 17:82711677-82711699 GGGCGCCGGGCTCTGGGTGGGGG + Intergenic
1153219068 18:2846840-2846862 CGGCAGGGGGCTCGGGGTGGAGG - Intergenic
1153245056 18:3065550-3065572 GGGTGGCGGGGTGGGGGTGGGGG - Intergenic
1153464948 18:5378843-5378865 CGGTGGGGGGGTGGGGGTGGGGG - Intergenic
1153636574 18:7117909-7117931 CGGGGGAGGGGTCTGGGTGGCGG - Intergenic
1153773399 18:8433098-8433120 CGGCGGCGGGGTGGGGGTCCAGG + Intergenic
1154177270 18:12093701-12093723 AGGCGGGGGGCGGTGGGAGGTGG + Intergenic
1154355676 18:13621841-13621863 CGGCGGTGGGTTGTGGAGGGTGG + Intronic
1154485877 18:14871066-14871088 GGGTGGGGGTCTGTGGGTGGGGG - Intergenic
1155153722 18:23141612-23141634 AGGCGGGGGCCTGTGGATGGTGG + Intronic
1157260777 18:46174160-46174182 CGGCAGCGAGCAGTGGGTCGCGG - Exonic
1157867231 18:51197323-51197345 CGGCGGCGCGCTGTCAATGGCGG + Intronic
1159999760 18:75005703-75005725 TGGCGGCGGGGGGTGGGTGGGGG - Intronic
1160034323 18:75286822-75286844 CGGCAGCCGCGTGTGGGTGGTGG - Exonic
1160151910 18:76401776-76401798 CGGCGCGGGGGTGTGGTTGGTGG - Intronic
1160151930 18:76401839-76401861 CGGCGCGGGGGTGTGGTTGGTGG - Intronic
1160374391 18:78400402-78400424 CGGCGGCTGTTTCTGGGTGGGGG - Intergenic
1160680104 19:408493-408515 TGCCGGCGGGGTGGGGGTGGAGG + Intronic
1160864932 19:1252292-1252314 CTGCTGAGGGCTGGGGGTGGCGG + Intronic
1160930583 19:1567986-1568008 CGGCGGCGGCGTGGGGGCGGCGG - Exonic
1160965238 19:1744524-1744546 CAGCACCGGGCTGTGGGGGGAGG + Intergenic
1160995291 19:1879599-1879621 CGGCGGGAGGGAGTGGGTGGTGG - Intronic
1161224461 19:3136606-3136628 GGTCGGTGGGCGGTGGGTGGTGG + Intronic
1161343276 19:3754096-3754118 CATCGGGGGCCTGTGGGTGGCGG + Exonic
1161400937 19:4066016-4066038 CCGCGGCGGGCTGTCGGCGCGGG + Intronic
1161401228 19:4066950-4066972 GGGGGGCGGGCTGGGCGTGGGGG - Intergenic
1161407986 19:4101148-4101170 AGGCGGCAGGCTGCGGGTGAGGG + Intronic
1161522039 19:4730101-4730123 CTGGGGAGGGGTGTGGGTGGAGG - Intergenic
1161605808 19:5214323-5214345 GGGCTGGGGGCTGAGGGTGGAGG - Intronic
1161680800 19:5678734-5678756 GGGCGGTGGGGGGTGGGTGGGGG + Intronic
1161851395 19:6739695-6739717 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
1161960855 19:7522454-7522476 CGCCGACGCGCTCTGGGTGGCGG - Intergenic
1162030089 19:7913515-7913537 GGGGGCCGGGCTGAGGGTGGGGG + Exonic
1162038009 19:7952947-7952969 CGGCCACGGGCTGTGGGTTGGGG + Intergenic
1162182003 19:8876336-8876358 TGGTGGTGCGCTGTGGGTGGGGG + Intronic
1162312437 19:9914860-9914882 CGGCCGCGGGCTGAGGGCGACGG - Intronic
1162435274 19:10654423-10654445 CCCCGGCGGGCTGTGGCAGGAGG + Exonic
1162547049 19:11337142-11337164 GGGAGGCTGGCTGTGGGTTGGGG - Intronic
1162644155 19:12036199-12036221 CGGCGGTGGGCTGGGGGGGTGGG + Intronic
1162751773 19:12833898-12833920 CGGCGGCGGGAGGAGGGAGGAGG - Intronic
1163000395 19:14363372-14363394 CGGGGGCGGGGTGAGGGTGCTGG - Intergenic
1163293550 19:16396932-16396954 CTGCCAGGGGCTGTGGGTGGGGG + Intronic
1163442422 19:17328676-17328698 CGGCGGCGGGCGGGGGAAGGCGG - Exonic
1163463980 19:17455584-17455606 CGGGGGTGGGGTGGGGGTGGAGG + Exonic
1165040235 19:33063803-33063825 GGGCGGCGGGCGGCGGGTGGCGG - Intronic
1165040238 19:33063810-33063832 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
1165040241 19:33063817-33063839 TGGCGGCGGGCGGCGGGCGGCGG - Intronic
1165093542 19:33398505-33398527 CGGCGGAGGGCTCTCCGTGGAGG + Intronic
1165108146 19:33486546-33486568 CAGAGGTGGGCTGAGGGTGGTGG - Intronic
1165213711 19:34254656-34254678 CGGGGTCGGGCGGTGGGCGGTGG + Intronic
1165354252 19:35293924-35293946 CGGCCGGGGCCTGGGGGTGGCGG - Intronic
1165596532 19:37014572-37014594 CGGCGGCGGCTTGGGGGAGGAGG - Intronic
1165828762 19:38720180-38720202 CCGCTGCGGGCTGTGGGGGATGG - Intronic
1165860171 19:38905264-38905286 AGGCGCCGGGCTGTGTGTGGCGG + Exonic
1165960792 19:39532673-39532695 CGGCGGCGGGGTTCGGGTGCAGG - Exonic
1166003432 19:39891812-39891834 CGCCAGCGGGCCGTCGGTGGCGG + Exonic
1166105677 19:40597070-40597092 CGGCGCCGGGCTGTGATTGGCGG + Intronic
1166705596 19:44906322-44906344 CGGCGGTGGGGAGGGGGTGGGGG + Intronic
1166709450 19:44927308-44927330 GGGCGATGGGCTGTGGGAGGAGG + Intergenic
1166851459 19:45763439-45763461 CGGCCCCGAGGTGTGGGTGGGGG + Intronic
1167146013 19:47681120-47681142 GGGCGGCGGCCTGTGGGGTGGGG - Exonic
1167178822 19:47885637-47885659 GGGAGTGGGGCTGTGGGTGGAGG - Intronic
1167377658 19:49120224-49120246 CGGCGGCAGGAGGTGGGGGGAGG - Intronic
1167618495 19:50548864-50548886 CGCTGGGGGGCTGTGGGTGGGGG + Exonic
1168064016 19:53909336-53909358 CGGCCGCGGGGGGTGGGGGGTGG + Exonic
1168212787 19:54902840-54902862 AGGAGGCGGGCTGGGTGTGGTGG + Intergenic
1168240981 19:55088808-55088830 GGGGGGCGGGGTGGGGGTGGGGG - Intergenic
1202683495 1_KI270712v1_random:30080-30102 CGGCGGCGGCGGGTGGGGGGGGG - Intergenic
925018020 2:546350-546372 TGGCGGGCGGCTGTGGGTTGGGG + Intergenic
925068730 2:950507-950529 CGGCGGTGGGCGGAGGGGGGCGG - Intergenic
925375016 2:3378027-3378049 CGGAGGCCGGCTGTGGGTGGAGG + Intergenic
925404746 2:3598739-3598761 TGGAGGCGGGCCGTGGGTGCGGG + Intronic
926285177 2:11482602-11482624 CGGCGGCCGGCGATGGGTGGAGG - Intergenic
926394390 2:12426201-12426223 GGATGGCAGGCTGTGGGTGGGGG + Intergenic
926474744 2:13308405-13308427 CGGCGGTGGGCTGGGCGGGGTGG + Intergenic
926980245 2:18560512-18560534 GGGCGGGGCGCTGTGGCTGGCGG - Exonic
927606595 2:24491591-24491613 CGGCGGCGGCAGGTGAGTGGCGG + Intergenic
928314963 2:30237887-30237909 GGCAGGCAGGCTGTGGGTGGCGG + Intronic
929011222 2:37447258-37447280 GGGCGGCGGGCGGTGGCGGGGGG + Intergenic
929031865 2:37656985-37657007 TGGCGGGGGGCGGGGGGTGGGGG - Intronic
929218133 2:39437184-39437206 CGGCGGCGGGCCGCGGGGGGCGG - Exonic
932140570 2:69273680-69273702 GGGTGGAGGGGTGTGGGTGGGGG - Intergenic
932593156 2:73079273-73079295 CGCAGGGGAGCTGTGGGTGGGGG - Intronic
932635743 2:73386221-73386243 CCGCGGCGAGTTGGGGGTGGAGG + Intronic
932820705 2:74897495-74897517 CGGCGGCGGGGAGGGGGAGGTGG - Intergenic
933278219 2:80304613-80304635 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
933278222 2:80304620-80304642 GGGCGGCGGGCGGCGGGCGGTGG + Exonic
933728178 2:85437973-85437995 GGGCGGGGGGCTGGGGGCGGGGG + Intergenic
933858600 2:86441968-86441990 CGGGGGCGGCCGGTGGGAGGGGG - Intronic
933948565 2:87308937-87308959 CGGGGACAGGCTGGGGGTGGCGG + Intergenic
934746671 2:96763875-96763897 CTGCGGTGGGGTGGGGGTGGGGG + Intronic
935963446 2:108449256-108449278 CGGCGGCGGGCTGGCGGAGATGG + Exonic
936331634 2:111552658-111552680 CGGGGACAGGCTGGGGGTGGCGG - Intergenic
936569884 2:113603924-113603946 CGTCGCTGGGCTGAGGGTGGCGG + Intergenic
936939634 2:117871055-117871077 CGGCGGCGGGGAGAGGGAGGGGG - Intergenic
936950757 2:117975076-117975098 CAGCAGCTGGCTGTGGGAGGTGG + Intronic
937389291 2:121469311-121469333 CAGGGTCGTGCTGTGGGTGGTGG - Intronic
937975511 2:127580022-127580044 CCTCGGAGGGCTGTGGGTGCTGG + Intronic
938078395 2:128354453-128354475 CGGGGTCTTGCTGTGGGTGGGGG - Intergenic
940453739 2:153871877-153871899 AGGCGGCGGGCTGGGGTGGGAGG + Intergenic
940646043 2:156393983-156394005 CGGGGGCGGGAAGGGGGTGGGGG + Intergenic
941164779 2:162073606-162073628 AGACCGCGGGCTGGGGGTGGGGG + Intronic
941917825 2:170823656-170823678 TGGCGGCAGGGTGGGGGTGGAGG - Intronic
941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG + Intronic
942558751 2:177198665-177198687 CCGCGGTGGGCTGAGGGTTGGGG - Intergenic
942596627 2:177597624-177597646 GGGCAGCGGGGGGTGGGTGGGGG + Intergenic
945037499 2:205716560-205716582 AGGGGGCGGGCTGTGGGCGGGGG + Intronic
945225845 2:207530389-207530411 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
945699421 2:213151736-213151758 CGGCGGCGGGCGGCTGGCGGCGG + Intronic
946340032 2:219060760-219060782 CGGCGGGGGGCGGCGGGCGGCGG + Intergenic
947188223 2:227472944-227472966 GGGCGCCGGGCTGTGGGGGGTGG + Intronic
947196523 2:227573533-227573555 CTGCGGAGGGTTGGGGGTGGAGG + Intergenic
947743685 2:232496879-232496901 AGGCTGGGGGCGGTGGGTGGTGG - Intergenic
948682533 2:239645679-239645701 CGGCGGGGGGCGGGGGGGGGAGG - Intergenic
948695091 2:239729324-239729346 CTGGGGCCTGCTGTGGGTGGGGG + Intergenic
948854757 2:240724928-240724950 CGGCGGCGGGGGGGGGGGGGGGG + Intronic
949077698 2:242071580-242071602 CGGCGGCTGACTGTGTGTGGGGG + Intergenic
949088880 2:242182417-242182439 CGTCGCTGGGCTGAGGGTGGCGG - Intergenic
1168756766 20:324168-324190 GGGGGGCGGGGTGGGGGTGGTGG - Intergenic
1168804451 20:664215-664237 CGGCGGCGGGGCGGGGGCGGCGG - Exonic
1168992006 20:2103035-2103057 CGGCGACGGCCTGAGGGCGGTGG + Exonic
1169087836 20:2838435-2838457 CTGCGGCGGGATGTGGTTGAAGG - Exonic
1169141819 20:3230901-3230923 TGGCGGTGGGCGGTGGGTGGGGG - Intronic
1169195961 20:3682123-3682145 CGAGGGCGGGCGGTGGGAGGTGG - Exonic
1169538869 20:6578638-6578660 TGGTGGCAGGCAGTGGGTGGGGG + Intergenic
1170578594 20:17681886-17681908 CGGCGGCAGGCGGCGGGCGGCGG + Intronic
1171371120 20:24662644-24662666 CAGCGGTGGGCTGGGGGTAGGGG - Intronic
1171473597 20:25390774-25390796 GGGCTCCGGGCTCTGGGTGGCGG - Exonic
1172099398 20:32476149-32476171 CGAAGGAGGGCTGTGGGTGGAGG - Intronic
1172143915 20:32743278-32743300 CGGCGGCGGGGCGTGGGGCGCGG - Intronic
1173673020 20:44810773-44810795 AGTCGGCCGGCTGAGGGTGGGGG - Intergenic
1173730482 20:45325143-45325165 CGGGGGTGGGCAGAGGGTGGGGG - Intergenic
1173741909 20:45407271-45407293 CGGCCGCGGGCTGGCGGCGGAGG - Intronic
1173750171 20:45470089-45470111 CTGCAGTGGGCTGGGGGTGGGGG + Intronic
1174444688 20:50582736-50582758 CAGAGGCGGACAGTGGGTGGAGG - Exonic
1174494603 20:50930885-50930907 CGGCGGCGGGCGGATGGCGGCGG + Exonic
1175203319 20:57292464-57292486 CGGCAGCAGGGGGTGGGTGGGGG + Intergenic
1175429407 20:58891328-58891350 CCGCGGCGGGCGGGGGGAGGCGG - Intronic
1175490584 20:59378291-59378313 GGGTAGCGGGCTGGGGGTGGAGG + Intergenic
1175856025 20:62121726-62121748 CTGCGGCAGGCTTTGGGAGGAGG + Intergenic
1175931672 20:62496513-62496535 CGGTTGCGGGGTGGGGGTGGCGG + Intergenic
1175944135 20:62550970-62550992 CGGCGGCGGGCGCAGGGTCGCGG - Exonic
1176005797 20:62861709-62861731 GGGCGGCGGGCGGCGGGAGGCGG + Exonic
1176083421 20:63285149-63285171 CGGAGGTGGGCTGGGGGTGCTGG - Intronic
1176083440 20:63285207-63285229 CGGAGGTGGGCTGGGGGTGCTGG - Intronic
1176550122 21:8217268-8217290 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176569050 21:8400303-8400325 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1176576964 21:8444538-8444560 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1177782842 21:25639357-25639379 CGCGGGCAGGCTGGGGGTGGGGG - Exonic
1178334425 21:31731445-31731467 CGGGGGTGGGCAGTGGGGGGAGG + Intronic
1179209361 21:39312968-39312990 CGGGGGCGGGCGGCGGGCGGCGG + Intronic
1179209366 21:39312975-39312997 GGGCGGCGGGCGGCGGGCGGGGG + Intronic
1179466820 21:41581421-41581443 GGGCGGCGGGCGGGGTGTGGAGG - Intergenic
1180095934 21:45555312-45555334 CGGCGGGGGGCGGCGGGGGGCGG + Intergenic
1180129618 21:45819209-45819231 TGGTGGCGGGCTGTGGGGGATGG + Intronic
1180169930 21:46052846-46052868 CAGAGGCGGGCTGTGGGTGACGG - Intergenic
1180169936 21:46052877-46052899 CGGGGCAGGGCTGTGGGTGACGG - Intergenic
1180799675 22:18625916-18625938 CTGCGAGGGGCTGTGGGTGCTGG + Intergenic
1180956539 22:19743811-19743833 CAGAGGGGGGCTGTGGGTAGGGG - Intergenic
1180965770 22:19787313-19787335 CAGTGCCGGGCTGGGGGTGGGGG - Exonic
1181085433 22:20437501-20437523 CGGCGCCGGGCATTGGGAGGGGG - Intronic
1181222041 22:21369350-21369372 CTGCGAGGGGCTGTGGGTGCTGG - Intergenic
1181457959 22:23070353-23070375 TGGCGGCGGGCGGCGGGCGGCGG + Exonic
1181745481 22:24952786-24952808 CGGCTGCGGGCAGTGGGGGCCGG + Intronic
1182245010 22:28950258-28950280 GGGCAGGGGGCGGTGGGTGGAGG - Intronic
1182419995 22:30244410-30244432 AGGCAGTGGGCTGTGGGTGCTGG - Intronic
1182536505 22:31007763-31007785 AGGAGGCCGGGTGTGGGTGGTGG + Intergenic
1183264935 22:36819201-36819223 CCACGGGGGGCGGTGGGTGGGGG + Intronic
1183409854 22:37648441-37648463 GGGCCGCGGGCTGGGGGAGGTGG + Intronic
1183517146 22:38273106-38273128 GGGCGGCGGGCTGGGGTTCGGGG - Intergenic
1183517155 22:38273126-38273148 GGGCGGCGGGCTGGGGTTCGGGG - Intergenic
1183671681 22:39276551-39276573 GGGGGGCGGGGTGTGGGTGATGG - Intergenic
1183702931 22:39459965-39459987 CGGCAGAGAGCTGAGGGTGGGGG + Intronic
1183720180 22:39557888-39557910 GGGCGGCGGGCGGGGGGCGGCGG - Intergenic
1183990515 22:41594375-41594397 CGGTGGGGGGGTGGGGGTGGGGG + Intergenic
1184118901 22:42437844-42437866 CGGCGGAGGGCTGTCGGTACAGG + Intergenic
1184226642 22:43132610-43132632 GGGGGGCAGGCTGGGGGTGGTGG + Exonic
1184234931 22:43178249-43178271 CAGGGGTGGGCTGTGGGTGGGGG - Intronic
1184372468 22:44091189-44091211 AGGATGCTGGCTGTGGGTGGAGG + Intronic
1184593900 22:45502956-45502978 GGGCGACGGGCGGTGGGCGGCGG - Exonic
1184692304 22:46122866-46122888 CGGCTGGGGGCTGTGGGTGGAGG + Intergenic
1184796953 22:46738232-46738254 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
1184796956 22:46738239-46738261 GGGCGGCGGGCGGCGGGAGGCGG + Exonic
1184947465 22:47813701-47813723 TGGCTGCGGGGTGAGGGTGGTGG + Intergenic
1185067845 22:48640894-48640916 CAGTGGGGGGCTGTTGGTGGGGG + Intronic
1185067871 22:48640991-48641013 CAGTGGGGGGCTGTTGGTGGGGG + Intronic
1185067898 22:48641088-48641110 CAGTGGGGGGCTGTTGGTGGGGG + Intronic
1185151230 22:49164862-49164884 TGGGGGAGGGCTGTGGGTGGGGG - Intergenic
1185189530 22:49425635-49425657 CCTTGGAGGGCTGTGGGTGGGGG + Intronic
1185272883 22:49936758-49936780 GGATGGAGGGCTGTGGGTGGAGG - Intergenic
1185335093 22:50267791-50267813 CGGGGGAGGGCCGTGGGGGGAGG - Intronic
1203255015 22_KI270733v1_random:133600-133622 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203263071 22_KI270733v1_random:178679-178701 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
950345316 3:12287835-12287857 CGGGCGCCGGCTGGGGGTGGGGG - Intronic
950666337 3:14497529-14497551 CGGCGGCTGGTGGTGGCTGGGGG + Intronic
950683988 3:14603214-14603236 CGGGGGCGGGATGGCGGTGGGGG + Intergenic
950779094 3:15375666-15375688 CGGCGGCGGGACGTAGGTGCTGG + Intergenic
952167232 3:30763501-30763523 CGGCGGCGGGGGGTGGGGGTGGG + Intronic
952241187 3:31532828-31532850 GGCCGGCGGACTGGGGGTGGAGG - Exonic
952301336 3:32106764-32106786 CGGCGGCGGGCTGGAGGCCGGGG + Intronic
952899429 3:38099769-38099791 CGGGGGCGGGGTGGGGGTGGGGG + Intronic
952917159 3:38255521-38255543 TGGCGGAGAGCTGTGGGTTGTGG + Intergenic
953618222 3:44510726-44510748 TGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618225 3:44510733-44510755 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618228 3:44510740-44510762 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618231 3:44510747-44510769 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618234 3:44510754-44510776 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953908841 3:46882063-46882085 CGGCGGCGGGATGTGAGTGCTGG - Intronic
953974388 3:47371384-47371406 CGGCGGCGGGGTGGGGGTGGGGG - Intergenic
954143267 3:48621261-48621283 AGGGTGCTGGCTGTGGGTGGTGG + Intronic
954337782 3:49929777-49929799 CGGCGGCCGGGTGAGGGCGGTGG - Exonic
954373673 3:50183332-50183354 CGGTGGCGAGCTGTGGGGAGGGG + Intronic
954414736 3:50387731-50387753 AGGAGGGGGGCTCTGGGTGGGGG - Intronic
954717476 3:52533781-52533803 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
956675096 3:71725488-71725510 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
956675099 3:71725495-71725517 AGGCGGCGGGCGGCGGGCGGCGG - Intronic
961523859 3:127484217-127484239 GGGCTGCGGGCTGTGGGCTGTGG - Intergenic
961827473 3:129606574-129606596 CGGCGGGGGGCTGGCGGCGGCGG + Exonic
962169229 3:133083171-133083193 GGGCGGCGGGGGGTGGGGGGGGG - Intronic
962804364 3:138916166-138916188 GGGCTGCGGGCTGTGGGCTGTGG - Intergenic
963451138 3:145482887-145482909 GGGCGGGGGGCTGAGGGAGGTGG - Intergenic
964665993 3:159172767-159172789 GGGCGGGGGGGTGGGGGTGGGGG + Intronic
964726268 3:159817306-159817328 GGGTGGCGGGCTGCGGGTGGCGG + Intronic
964918211 3:161861519-161861541 CGGGGGCAGGCGGAGGGTGGGGG + Intergenic
965793328 3:172411794-172411816 GGGTGGCGGGCTGCGGGAGGCGG + Intergenic
966595784 3:181723787-181723809 TGGCGGCTGGCTGTGGGTCGAGG - Intergenic
966831923 3:184017513-184017535 CGCCCGCGGGCCGTGGGTGTGGG - Intronic
967165566 3:186776566-186776588 TGGCGGGGGTCTGGGGGTGGAGG + Intergenic
967330946 3:188288820-188288842 GGGCGGGGGGGTGGGGGTGGGGG - Intronic
968064513 3:195751139-195751161 GGGTGGGGGGCTGGGGGTGGGGG + Intronic
968517946 4:1022703-1022725 CAGCGGAGGGCGGAGGGTGGAGG + Intronic
968545051 4:1194180-1194202 CGTCGTGGGGCTGGGGGTGGAGG - Intronic
968649103 4:1753397-1753419 CTGCTGGGGGCTGGGGGTGGGGG + Intergenic
968674899 4:1871838-1871860 GGGCGGCGGCCTGCGGGCGGCGG + Intronic
968803279 4:2756517-2756539 CGGGGCCGGGCTGTAGGCGGTGG - Intergenic
969311402 4:6354810-6354832 CTGTGGGGGGCTGTGGGCGGAGG - Intronic
969606209 4:8203495-8203517 CGGGGGAGGGCTGGGGGTGCTGG + Intronic
970441452 4:16083798-16083820 CCGCGGCCGGCAGTGGGAGGCGG - Intronic
972532941 4:39977200-39977222 TGGCGTGGGGCTGAGGGTGGAGG - Intronic
972671459 4:41216413-41216435 CGGCGGCGGGGGGGGGGGGGGGG + Intronic
973848439 4:54936966-54936988 CTGCTGGGGGCTGTGTGTGGTGG + Intergenic
975139163 4:70902600-70902622 GGGCGGCGGGCGGCGGGCGGGGG - Intronic
976226336 4:82798069-82798091 CCGCGGCGGGGTGGGGGCGGGGG + Intronic
976246670 4:83012355-83012377 CGGCGGCGGGCAGTAGGGAGAGG + Intronic
977564622 4:98568527-98568549 TGGTGGTGGGCTGGGGGTGGGGG - Intronic
978361027 4:107931519-107931541 CGGGGGCGGGCAGGGGGTGTAGG - Exonic
978620461 4:110631401-110631423 GGGCCGAGGGCTGTGGGGGGGGG + Intronic
978781012 4:112554206-112554228 CTGGGGCGTGTTGTGGGTGGGGG - Intronic
981745641 4:148049844-148049866 GGGCGGGGGGCGGGGGGTGGTGG + Intronic
981881338 4:149616731-149616753 CGGCAGCGGGGTGTGGGGAGGGG + Intergenic
984888951 4:184474580-184474602 CGGAGGAGGGCGGGGGGTGGGGG - Exonic
985058982 4:186057859-186057881 GGGTGGCGGGAGGTGGGTGGCGG - Intergenic
985064063 4:186104744-186104766 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
985466709 4:190203624-190203646 CGTCGCTGGGCTGAGGGTGGCGG - Intergenic
985467720 5:13053-13075 CGTCGCTGGGCTGAGGGTGGCGG + Intergenic
985758475 5:1733068-1733090 TGGCAGCTGGCTGGGGGTGGGGG - Intergenic
985782072 5:1876652-1876674 GGGCGGAGGGCTCGGGGTGGGGG + Intergenic
985784460 5:1886703-1886725 CGGCGCGGGGCGGGGGGTGGGGG - Intronic
985857482 5:2441586-2441608 AGGAGGCGGGCTCTTGGTGGGGG + Intergenic
985896302 5:2751576-2751598 CGGCGGCGGGGTGGCGGTGGCGG + Exonic
985977272 5:3430132-3430154 CAGCAGGGGGCTGTGGGTGCGGG + Intergenic
986339085 5:6774432-6774454 CAGCGGCGGGGGGTGTGTGGGGG - Intergenic
987444147 5:17995789-17995811 CGGTGGCCAACTGTGGGTGGTGG - Intergenic
988930906 5:36034887-36034909 AGGCAGCGGGAAGTGGGTGGAGG - Intergenic
988934772 5:36071028-36071050 AGGCAGCGGGAAGTGGGTGGAGG - Intronic
989380874 5:40808367-40808389 AGGGGGCGGGTTGGGGGTGGTGG + Intergenic
991270952 5:64780068-64780090 TTGCTGGGGGCTGTGGGTGGAGG - Intronic
992786854 5:80178349-80178371 CGGGGGTGGGGTGGGGGTGGGGG - Intronic
997485273 5:134225925-134225947 CGGCGGCGGCGTGTGCGTGTAGG - Exonic
997975391 5:138439009-138439031 CAGCGGCGGGCCGTGGGCGGTGG - Exonic
998366650 5:141636819-141636841 CGGCCGCGGGCGGCGGGCGGCGG - Exonic
998426747 5:142035285-142035307 CTGTGCCTGGCTGTGGGTGGGGG + Intergenic
998481951 5:142470124-142470146 TGGTGGCTGGCTCTGGGTGGAGG + Intergenic
998946944 5:147350161-147350183 TAGCGGGGGGCGGTGGGTGGGGG - Intronic
999093669 5:148958974-148958996 CAGCAGCGGGGTGGGGGTGGTGG - Intronic
999286084 5:150395110-150395132 CTGCGGTGGGCTGGGGGAGGTGG - Intronic
999725052 5:154430232-154430254 GGGCTGTGGGCTGTGAGTGGAGG - Intergenic
1001064992 5:168529367-168529389 GGGCGGCGGGCGGCGGGCGGCGG - Exonic
1001064995 5:168529374-168529396 CGGAGGCGGGCGGCGGGCGGCGG - Exonic
1002105956 5:176879541-176879563 CGGCGGCGGGGTGGGTGAGGTGG + Intronic
1002201551 5:177531512-177531534 CAGCGGGTGGCTGGGGGTGGGGG + Intronic
1002904530 6:1438102-1438124 CGGAGGTGGGGTGGGGGTGGGGG - Intergenic
1002930838 6:1633898-1633920 CGCCTGCAGGCTGTGGCTGGAGG + Intronic
1004478725 6:15998951-15998973 CGGGGGTGGGGGGTGGGTGGGGG + Intergenic
1005648863 6:27867655-27867677 CGGCGGCGGCCAGAGGGCGGTGG - Intergenic
1005987795 6:30884892-30884914 CGGGGGCGGGGACTGGGTGGAGG + Intronic
1006454178 6:34122604-34122626 CAGCGGTGGGCGGGGGGTGGGGG + Intronic
1006583330 6:35089072-35089094 AGGCGGTGGCCTGTGGGTGAGGG + Exonic
1007223534 6:40296990-40297012 CCGGGGTGGGCTGGGGGTGGGGG + Intergenic
1007361362 6:41358700-41358722 TGGGGGCGGGCGGGGGGTGGGGG - Intergenic
1007765368 6:44156686-44156708 TATGGGCGGGCTGTGGGTGGAGG + Intergenic
1008085150 6:47236594-47236616 CAGCAGCAGGGTGTGGGTGGTGG - Intronic
1010001590 6:70955412-70955434 CGGTGGAGGGGTGGGGGTGGTGG - Intronic
1013459066 6:110358132-110358154 CGGCGGGGCGCTGCGGGTGGGGG + Exonic
1014079524 6:117270808-117270830 CGGCGGCGGGGCGCGGGTAGGGG - Exonic
1014434686 6:121408505-121408527 CGGCGGCGGGATGTAGGCGCTGG - Intergenic
1015625989 6:135181439-135181461 AGGCGGCGGGCAGCGGGAGGCGG + Exonic
1016386847 6:143537313-143537335 TGGCGGCGGGGTGGGGGTGGGGG + Intronic
1018774128 6:166998587-166998609 CGGCGCCTGGCTGTCGGCGGAGG + Intergenic
1018896032 6:168017887-168017909 AGGCGGCAGGCTGGGGTTGGTGG + Intronic
1018959923 6:168441066-168441088 CGGCAGCGGGCGCTGGGAGGTGG + Intergenic
1019294348 7:266150-266172 CGGCTGTGGGCTGTGGGCTGGGG - Intergenic
1019294364 7:266218-266240 CGGCTGTGGGCTGTGGGCTGGGG - Intergenic
1019331401 7:462489-462511 CGGCTGTGGGCTGTGGGCTGTGG + Intergenic
1019472762 7:1229989-1230011 CGGGGGCGGCGGGTGGGTGGGGG + Intergenic
1019538369 7:1540379-1540401 CGGCCGGGGGCGGGGGGTGGCGG + Exonic
1019770908 7:2883205-2883227 TGGCGGCCAGCTGGGGGTGGGGG + Intergenic
1019828567 7:3302607-3302629 CGGGGGCGGGGAGGGGGTGGAGG - Intronic
1019835325 7:3377705-3377727 GGGCAGGGGGCTGTGTGTGGGGG + Intronic
1020007443 7:4790065-4790087 GGGTGTGGGGCTGTGGGTGGGGG - Intronic
1020136944 7:5592887-5592909 CGGCCCCGGGAGGTGGGTGGCGG - Exonic
1022099645 7:27161523-27161545 TGGCGGCGGGGTGGGGGTGGGGG + Intergenic
1023067283 7:36390193-36390215 CTGCGGCCTGCTGTGGTTGGTGG + Intronic
1023376964 7:39566287-39566309 CGGAGGCGGGCTGTGGCCCGTGG - Intergenic
1023743723 7:43303089-43303111 GGGCAGGGGGCTGTGGGTGTGGG - Intronic
1023880043 7:44313148-44313170 AGGCAGCGGGAGGTGGGTGGAGG - Intronic
1023888370 7:44376292-44376314 CGGGGGGGGGTTGGGGGTGGAGG - Intergenic
1023915048 7:44582366-44582388 GGGCGCCGGGCTGTGTGAGGGGG - Intergenic
1024499832 7:50093188-50093210 CGACGGCGGCGTGTGGATGGAGG - Exonic
1024578294 7:50782372-50782394 GGGCGGTGGGCGGTGGGCGGTGG - Intronic
1025069765 7:55887804-55887826 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069768 7:55887811-55887833 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069771 7:55887818-55887840 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069774 7:55887825-55887847 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069783 7:55887848-55887870 CGGCGGCGGGCGGCGGGCGGCGG + Intronic
1026541369 7:71282689-71282711 CAAGGGAGGGCTGTGGGTGGGGG + Intronic
1026874473 7:73871485-73871507 CTGCAGCGGCCTGTGGCTGGAGG + Intergenic
1026940536 7:74285328-74285350 CTGTGGTGGGCTTTGGGTGGGGG - Intergenic
1027374518 7:77537125-77537147 CGGCTGCTGGCGGGGGGTGGGGG + Intergenic
1028086852 7:86645981-86646003 GGGCGGGGGGGTGGGGGTGGGGG + Intronic
1028173640 7:87628548-87628570 CGGCGGCGCGCCGAGGGCGGAGG + Exonic
1028485561 7:91353658-91353680 TGGCGGCGGGGTGGGGGAGGTGG + Intergenic
1029080947 7:97973482-97973504 TGACGGCGGGGGGTGGGTGGTGG - Intergenic
1029206071 7:98870032-98870054 GCGCAGCGGGCTGTGGGCGGCGG - Intronic
1029407125 7:100382002-100382024 CGGGGGTGGGGTGGGGGTGGGGG - Intronic
1029413902 7:100431209-100431231 CTGCTGCAGGCAGTGGGTGGTGG - Exonic
1029480112 7:100807233-100807255 CAGGAGCAGGCTGTGGGTGGGGG - Intronic
1029640463 7:101816529-101816551 CGGCGGCGGGCGCCGGGAGGGGG + Intronic
1030598025 7:111562423-111562445 CGGCGTCCGGCGGCGGGTGGGGG - Intronic
1032068741 7:128791341-128791363 CGGCGGCGAGCGGCGGGGGGCGG + Intronic
1032092041 7:128915900-128915922 CGATGGCGGGGTGGGGGTGGGGG + Intergenic
1032151307 7:129432610-129432632 GGGCGGGGGGCTGGGTGTGGGGG - Intergenic
1032306293 7:130734442-130734464 GGGCGGCGGGCTGCGGGGAGGGG - Intergenic
1033092991 7:138404044-138404066 GGGCGGTGGGCAGTGGGTGGTGG + Intergenic
1033237416 7:139649246-139649268 CGGCGGGTGGCTGCGGGGGGCGG + Intronic
1033288652 7:140062894-140062916 CGGCGGCGGACGCTGGCTGGCGG + Exonic
1034451059 7:151137545-151137567 CGGCGGCCGGCAGTGGAGGGAGG - Intronic
1034469715 7:151248741-151248763 CGGCGGCGGGCGGGCGGCGGCGG - Exonic
1034547559 7:151799021-151799043 CGGCAGGGGGCTGGGGCTGGTGG - Intronic
1034620281 7:152451659-152451681 CGGCGGGGGGCGGGGGGGGGGGG - Intergenic
1034976339 7:155450959-155450981 CGCCGGCGGGATGTAGGTAGGGG - Intergenic
1035023041 7:155809893-155809915 AGGCGGCGGACTGGGGATGGGGG + Intronic
1035062520 7:156079934-156079956 CGGGGGTGGGGTGGGGGTGGGGG - Intergenic
1036644184 8:10601743-10601765 CAGAGGCGGGCAGTGAGTGGAGG + Intergenic
1036926661 8:12913559-12913581 AGGTGGTGGGTTGTGGGTGGAGG - Intergenic
1038613209 8:29071992-29072014 CGGCCGTGGGCGGTGGGGGGTGG + Exonic
1039921235 8:41895998-41896020 TGGCTGCCGGCTGCGGGTGGTGG - Intronic
1041374072 8:57194026-57194048 AGGCTGCGGGCTGCGGGAGGAGG + Intergenic
1042050188 8:64695381-64695403 GGGCGGCGGGCTGAGGGAGAAGG + Intronic
1042548811 8:69974995-69975017 TGGCGGGGGGCTGTGGGAGGGGG + Intergenic
1042916176 8:73878370-73878392 CGGCGGGGGGCTGAGTGTGCGGG - Intronic
1043401787 8:79891680-79891702 CGGCGGCGGGCTGAGTTGGGAGG - Intergenic
1044591445 8:93917269-93917291 CGTCGGGGGGCTGGGGGCGGGGG + Intronic
1044807908 8:96027553-96027575 TGGCTGCTGACTGTGGGTGGTGG - Intergenic
1045504301 8:102767701-102767723 AGGCAGTGGGCTGGGGGTGGAGG + Intergenic
1047871075 8:129082790-129082812 CTGGGGAGGGCTGTGGGTGGGGG + Intergenic
1047916811 8:129592241-129592263 AGGGGGCGGGGTGGGGGTGGGGG - Intergenic
1048198644 8:132353227-132353249 TGGCGGAGGGCTGGGGGTCGGGG - Intronic
1049154665 8:141059401-141059423 TGGGGGCGGGCTGGGGGTGGAGG + Intergenic
1049240655 8:141535951-141535973 GGGCGGCGGGCGGTGGGGAGGGG + Intergenic
1049510857 8:143026011-143026033 CTGCTGCTGGCTGAGGGTGGGGG - Intergenic
1049542406 8:143214574-143214596 GGGGGGTGGGCTGTGTGTGGTGG - Intergenic
1049579849 8:143406354-143406376 AGGCCGCGTGCTGTGGGTAGAGG - Intergenic
1049762280 8:144336911-144336933 CGGCGGCGGGCGGGGGGCGGGGG + Intergenic
1049766854 8:144358916-144358938 CGGCGTCCGGCTTGGGGTGGTGG + Exonic
1049831161 8:144701381-144701403 CGGAAGCGTGCTGGGGGTGGTGG + Intergenic
1049883077 9:11154-11176 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
1049998375 9:1051714-1051736 CGGCGGCGGGCTGGGCCCGGGGG - Exonic
1051418626 9:16870160-16870182 CGGCGGCTGGGCGTGGGTGCCGG - Intronic
1051896939 9:21996677-21996699 CGGAGGCCGGCTGAAGGTGGTGG - Intronic
1053034106 9:34810004-34810026 CGGCGGCGGCGCGTGGGCGGCGG - Intergenic
1053489437 9:38487983-38488005 CGGGGGCGGGCGGTGGGTGGTGG + Intergenic
1054407727 9:64775086-64775108 CTGCGGCGGGGGGGGGGTGGGGG + Intergenic
1054489413 9:65762585-65762607 CGGCGGCGGGGGGGGGGTGGGGG - Intergenic
1054719106 9:68585743-68585765 CGGCGGTGGGGCGGGGGTGGGGG - Intergenic
1055471173 9:76612569-76612591 TGGAGGTGGGCTGTGGGAGGGGG + Exonic
1057177890 9:93012681-93012703 CGGTGGCGGGGTGTGGGGGGGGG + Intronic
1057186117 9:93058543-93058565 CGGCCGGGGGCTGTGGGCGGGGG - Intergenic
1057669782 9:97077303-97077325 CGGGGGCGGGCAGTGGGTAGTGG + Intergenic
1060106773 9:120877425-120877447 CGGGGGCGGGCGGGGGCTGGCGG - Intronic
1060404607 9:123367176-123367198 CAGCGGCGAGCTGTGCGAGGTGG + Exonic
1060477919 9:123999598-123999620 CGGCGGCGGGCGGGGTGGGGAGG + Intergenic
1061059619 9:128243904-128243926 CAGCTGTGGGCTGTGGGTGCTGG + Intronic
1061108951 9:128553020-128553042 CGGCTGCGGCAGGTGGGTGGGGG + Intronic
1061149127 9:128818951-128818973 CCGCGGCGCGCTCTGGGTGGTGG + Exonic
1061378436 9:130239999-130240021 CGGGGGTGAGCTGTTGGTGGAGG + Intergenic
1061453544 9:130681749-130681771 CGGCGCCGGGCCGGGGGTTGGGG - Exonic
1061550917 9:131334216-131334238 TGGCGGGGGCCTGTGGGTGCAGG + Intergenic
1061604037 9:131694951-131694973 CGGGGGCCTGTTGTGGGTGGGGG - Intronic
1061718625 9:132537525-132537547 CGGGGGCGGGCGGTGGGGAGCGG + Intronic
1061859908 9:133462670-133462692 AGGCTGCAGGCTGTGGGTGGAGG + Intronic
1061932389 9:133839977-133839999 CGGGGGCGGGGAGTGGGGGGTGG - Intronic
1062162475 9:135087843-135087865 CGGCGGCGGGCGGGCGGCGGCGG + Exonic
1062314729 9:135961150-135961172 CGGCGGCGGGATGTTCGTGCAGG - Exonic
1062535271 9:137018538-137018560 AGGGGGCGGGTTGTGGGTTGGGG + Intronic
1062577475 9:137215377-137215399 GGACGGCGGGGTGGGGGTGGTGG - Intronic
1062625971 9:137441651-137441673 CGGCTGCGGGCCGTGGGGGGCGG - Intronic
1203790800 EBV:150677-150699 CGGCGTCGTGCTCCGGGTGGAGG + Intergenic
1203794596 EBV:169769-169791 GGGCTGCGGGCGGTGGATGGCGG + Intergenic
1203794797 EBV:170307-170329 GGGCTGCGGGCGGTGGATGGCGG + Intergenic
1203794988 EBV:170830-170852 GGGCTGCGGGCGGTGGATGGCGG + Intergenic
1203795189 EBV:171368-171390 GGGCTGCGGGCGGTGGATGGCGG + Intergenic
1203471415 Un_GL000220v1:116740-116762 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1203479236 Un_GL000220v1:160712-160734 CGGCGGCGGTCGGCGGGCGGCGG + Intergenic
1185711257 X:2305191-2305213 CTGGGGCGTGTTGTGGGTGGGGG + Intronic
1187937178 X:24347328-24347350 CGGAGGCGGGGTGGGGGTGGGGG - Intergenic
1188451232 X:30309471-30309493 CGGAGGCGGGCGGTGTGTGCGGG + Exonic
1189354235 X:40299101-40299123 CGGGGGCGGGGCGCGGGTGGGGG + Intergenic
1190320279 X:49175992-49176014 CGGCTGGGGGCCCTGGGTGGGGG + Exonic
1191211802 X:57892390-57892412 CGGCAGGGGGCGGTGGGTGGGGG + Intergenic
1192657276 X:73004307-73004329 CGGGGGAGGGCTGGGGGTGGGGG - Exonic
1192664844 X:73078700-73078722 CGGGGGAGGGCTGGGGGTGGGGG + Exonic
1193969963 X:88039127-88039149 GGGCGGGGGGCGGGGGGTGGGGG - Intergenic
1196653912 X:118197402-118197424 TGGAGGCGGGGGGTGGGTGGGGG - Intergenic
1198005470 X:132489313-132489335 GGCCGGCGGGCTGTGGGAGGAGG + Intronic
1198750635 X:139933282-139933304 CGCCGGCCGGCTGGGTGTGGAGG + Intronic
1199772502 X:150983759-150983781 CGGCTGCGGGCTGTGGGCGCTGG + Intronic
1199942152 X:152637680-152637702 CGGGGCCGGGCTGGGGGAGGGGG - Intergenic
1200100934 X:153688860-153688882 CGGCGGCCTGCTGGGGGAGGAGG - Intronic
1200239566 X:154486627-154486649 CGGCGGCGCGCGGCGGGGGGTGG - Exonic
1200277908 X:154751284-154751306 CGGGGGGGGGGTGTGGGGGGGGG + Intronic
1200402724 X:156028987-156029009 CGGCGCCGGGCTGGGGGCGGGGG - Intergenic