ID: 941959789

View in Genome Browser
Species Human (GRCh38)
Location 2:171242294-171242316
Sequence GTAAGTTTCTCTGAAGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941959789_941959794 -8 Left 941959789 2:171242294-171242316 CCTGCATCTTCAGAGAAACTTAC No data
Right 941959794 2:171242309-171242331 AAACTTACAAAAAATCAGGGGGG No data
941959789_941959798 19 Left 941959789 2:171242294-171242316 CCTGCATCTTCAGAGAAACTTAC No data
Right 941959798 2:171242336-171242358 TCTGGATCTATTCTGGTTCTGGG No data
941959789_941959793 -9 Left 941959789 2:171242294-171242316 CCTGCATCTTCAGAGAAACTTAC No data
Right 941959793 2:171242308-171242330 GAAACTTACAAAAAATCAGGGGG No data
941959789_941959792 -10 Left 941959789 2:171242294-171242316 CCTGCATCTTCAGAGAAACTTAC No data
Right 941959792 2:171242307-171242329 AGAAACTTACAAAAAATCAGGGG No data
941959789_941959795 1 Left 941959789 2:171242294-171242316 CCTGCATCTTCAGAGAAACTTAC No data
Right 941959795 2:171242318-171242340 AAAAATCAGGGGGGTCTCTCTGG No data
941959789_941959796 12 Left 941959789 2:171242294-171242316 CCTGCATCTTCAGAGAAACTTAC No data
Right 941959796 2:171242329-171242351 GGGTCTCTCTGGATCTATTCTGG No data
941959789_941959797 18 Left 941959789 2:171242294-171242316 CCTGCATCTTCAGAGAAACTTAC No data
Right 941959797 2:171242335-171242357 CTCTGGATCTATTCTGGTTCTGG No data
941959789_941959799 20 Left 941959789 2:171242294-171242316 CCTGCATCTTCAGAGAAACTTAC No data
Right 941959799 2:171242337-171242359 CTGGATCTATTCTGGTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941959789 Original CRISPR GTAAGTTTCTCTGAAGATGC AGG (reversed) Intergenic
No off target data available for this crispr