ID: 941963570 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:171277609-171277631 |
| Sequence | CAGAAAATGGCGAAGTTGTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941963564_941963570 | 12 | Left | 941963564 | 2:171277574-171277596 | CCCGGTCTCTGGTGGGCTCAATG | No data | ||
| Right | 941963570 | 2:171277609-171277631 | CAGAAAATGGCGAAGTTGTCAGG | No data | ||||
| 941963565_941963570 | 11 | Left | 941963565 | 2:171277575-171277597 | CCGGTCTCTGGTGGGCTCAATGG | No data | ||
| Right | 941963570 | 2:171277609-171277631 | CAGAAAATGGCGAAGTTGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941963570 | Original CRISPR | CAGAAAATGGCGAAGTTGTC AGG | Intergenic | ||
| No off target data available for this crispr | |||||