ID: 941963570

View in Genome Browser
Species Human (GRCh38)
Location 2:171277609-171277631
Sequence CAGAAAATGGCGAAGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941963564_941963570 12 Left 941963564 2:171277574-171277596 CCCGGTCTCTGGTGGGCTCAATG No data
Right 941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG No data
941963565_941963570 11 Left 941963565 2:171277575-171277597 CCGGTCTCTGGTGGGCTCAATGG No data
Right 941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941963570 Original CRISPR CAGAAAATGGCGAAGTTGTC AGG Intergenic
No off target data available for this crispr