ID: 941964277

View in Genome Browser
Species Human (GRCh38)
Location 2:171285207-171285229
Sequence TATGATCCTAAGTAAGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941964270_941964277 17 Left 941964270 2:171285167-171285189 CCAAAAGTGAGGACCCTGGTGAA No data
Right 941964277 2:171285207-171285229 TATGATCCTAAGTAAGGGCAGGG No data
941964273_941964277 -8 Left 941964273 2:171285192-171285214 CCAAACATTTACTGCTATGATCC No data
Right 941964277 2:171285207-171285229 TATGATCCTAAGTAAGGGCAGGG No data
941964272_941964277 3 Left 941964272 2:171285181-171285203 CCTGGTGAAATCCAAACATTTAC No data
Right 941964277 2:171285207-171285229 TATGATCCTAAGTAAGGGCAGGG No data
941964271_941964277 4 Left 941964271 2:171285180-171285202 CCCTGGTGAAATCCAAACATTTA No data
Right 941964277 2:171285207-171285229 TATGATCCTAAGTAAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941964277 Original CRISPR TATGATCCTAAGTAAGGGCA GGG Intergenic
No off target data available for this crispr