ID: 941964643

View in Genome Browser
Species Human (GRCh38)
Location 2:171288960-171288982
Sequence CAGGCACACCCATCGTAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941964633_941964643 29 Left 941964633 2:171288908-171288930 CCATGTGCAAAGCCATCTCCAGA No data
Right 941964643 2:171288960-171288982 CAGGCACACCCATCGTAAGCGGG No data
941964640_941964643 -3 Left 941964640 2:171288940-171288962 CCAGGGGAGTGAAACAGCGGCAG No data
Right 941964643 2:171288960-171288982 CAGGCACACCCATCGTAAGCGGG No data
941964638_941964643 11 Left 941964638 2:171288926-171288948 CCAGAGTTCTCTCTCCAGGGGAG No data
Right 941964643 2:171288960-171288982 CAGGCACACCCATCGTAAGCGGG No data
941964634_941964643 17 Left 941964634 2:171288920-171288942 CCATCTCCAGAGTTCTCTCTCCA No data
Right 941964643 2:171288960-171288982 CAGGCACACCCATCGTAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941964643 Original CRISPR CAGGCACACCCATCGTAAGC GGG Intergenic
No off target data available for this crispr