ID: 941967706

View in Genome Browser
Species Human (GRCh38)
Location 2:171315946-171315968
Sequence CAGTGTCATTGGCAAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941967706_941967713 -3 Left 941967706 2:171315946-171315968 CCAGGCACTTGCCAATGACACTG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 941967713 2:171315966-171315988 CTGGAGTAGGGGTAAGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 170
941967706_941967716 25 Left 941967706 2:171315946-171315968 CCAGGCACTTGCCAATGACACTG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 941967716 2:171315994-171316016 TGTGTAGTGTGTGACGTAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 92
941967706_941967712 -4 Left 941967706 2:171315946-171315968 CCAGGCACTTGCCAATGACACTG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 941967712 2:171315965-171315987 ACTGGAGTAGGGGTAAGCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941967706 Original CRISPR CAGTGTCATTGGCAAGTGCC TGG (reversed) Intergenic
901071190 1:6519549-6519571 CTGTGGCATTGGCATGTGGCTGG - Intronic
905204912 1:36337899-36337921 CAGTGTCCCTGGGAAGAGCCAGG - Intergenic
905997200 1:42391510-42391532 CGGTGTCATTGGCGAGAGACAGG + Intronic
911130897 1:94387162-94387184 CAGTGTTATTGCCAAGTGCCTGG + Intergenic
913553668 1:119941578-119941600 CAGTTACACTTGCAAGTGCCAGG - Exonic
914804661 1:150983304-150983326 CAGGGTAGTTGGCAAGGGCCAGG - Intronic
915659288 1:157388940-157388962 CAGTCTCACTGGCAAGTTGCAGG + Intergenic
916765423 1:167855535-167855557 CATTGTTATGGGCAAGTGACAGG - Intronic
917738396 1:177940507-177940529 CACTGACATTAGCAAGTCCCTGG - Intronic
922156088 1:223040642-223040664 CAGAGTCATGGGCAAGGGGCAGG + Intergenic
923421200 1:233817015-233817037 CAGTTTCACTGACAAGTGCTGGG - Intergenic
924167309 1:241297603-241297625 CAGTGTAATTGGCCAATGCTCGG + Intronic
924766768 1:247039761-247039783 CTGTCTCATTGGCAGGTGCAGGG + Intronic
1065821707 10:29531950-29531972 CTGTGTCATTGCCACGTTCCTGG + Intronic
1068683718 10:59847496-59847518 CAGGCTCATTTGCAAGTGACAGG - Intronic
1069534123 10:69240669-69240691 CGGTGTCATTGACCAGGGCCAGG - Exonic
1069797994 10:71065410-71065432 CAGGGTCACTGGCAAGTGTTGGG - Intergenic
1069919511 10:71807958-71807980 CAGAGTCGTTGGCAAGGGCCCGG - Exonic
1070896239 10:79984704-79984726 CAGTGTCATTTGAAAATGGCAGG - Intergenic
1073693917 10:105844276-105844298 CTGAGCCATTGGCAGGTGCCTGG - Intergenic
1073982718 10:109173301-109173323 CATAGTCCTTTGCAAGTGCCTGG + Intergenic
1080804789 11:35642539-35642561 TAGTGTCATGGCCAAGTGCATGG + Intergenic
1081654860 11:44850441-44850463 CAGGGACCTTGGGAAGTGCCTGG - Intronic
1088467727 11:110159501-110159523 CAGTATCATTGGCAAGTAAATGG - Intronic
1088935493 11:114395792-114395814 CAATGTCTTTGGCAAGTGGGTGG - Intronic
1088959714 11:114650802-114650824 CTTTGTCTTTGGCAAGTACCTGG - Intergenic
1091732388 12:2890779-2890801 CTGTCTCATTGGCTATTGCCGGG - Intronic
1092086499 12:5767228-5767250 TAGTGTCATGGGCAGGTGCAGGG + Intronic
1092183729 12:6463406-6463428 CCCTGTCTTTGGCAAGTGCACGG + Intronic
1092962030 12:13605453-13605475 CAGTCTCATTGGCCAATGCTTGG - Intronic
1098550567 12:71756678-71756700 CAGTGTCATTAGTGAGAGCCTGG + Intronic
1103821791 12:123704572-123704594 CAGTGTGAACGGCATGTGCCTGG + Exonic
1109720251 13:66267074-66267096 CAGAGTCATTGGACAGTGCCTGG - Intergenic
1109854476 13:68108985-68109007 CAGGTTCATTGCTAAGTGCCTGG - Intergenic
1110174212 13:72536786-72536808 CAGAGCCATTGGCAAGTTCCAGG + Intergenic
1112870063 13:103960201-103960223 CAGTGTCATTCACAAATGCATGG - Intergenic
1118459454 14:65975422-65975444 CAGTGTCATGGGCTAGTGGCTGG - Intronic
1119029030 14:71176996-71177018 CAGTGTGGTTGGCAAGGGCTGGG + Intergenic
1122013324 14:98772031-98772053 CAGCTTCATTGTCAAGAGCCAGG + Intergenic
1128608844 15:69058150-69058172 CAATCCCATTGGAAAGTGCCTGG - Intronic
1129458863 15:75689969-75689991 CAGTGTCAATGGCCAGAGGCGGG - Exonic
1130273010 15:82462122-82462144 CAGTGTCAATGGCTAGAGGCAGG + Intergenic
1130465360 15:84189481-84189503 CAGTGTCAATGGCTAGAGGCAGG + Intergenic
1130487329 15:84405327-84405349 CAGTGTCAATGGCTAGAGGCAGG - Intergenic
1130498905 15:84484055-84484077 CAGTGTCAATGGCTAGAGGCGGG - Intergenic
1130587651 15:85194088-85194110 CAGTGTCAATGGCTAGAGGCAGG + Intergenic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1131760088 15:95613022-95613044 CAGTGCTATTGGCAAATGCCAGG - Intergenic
1132910592 16:2308737-2308759 CCGTGTAGATGGCAAGTGCCAGG - Intronic
1132941860 16:2512514-2512536 CAGTGACCTTGGCAAGGGCAAGG + Intronic
1134183084 16:12063188-12063210 CAGGGGCCTTGGCATGTGCCTGG - Intronic
1136143645 16:28302599-28302621 CAGTGCCAGAGGAAAGTGCCAGG - Intronic
1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG + Intronic
1140886326 16:79247062-79247084 GAGTATAATGGGCAAGTGCCGGG + Intergenic
1145104208 17:20101631-20101653 CAGTGTCATTTGCGAGGCCCAGG + Intronic
1147183503 17:38701731-38701753 CAGTGACGATGTCAAGTGCCTGG - Intergenic
1147970002 17:44214146-44214168 GAGTGGCACTGGCAGGTGCCAGG + Intronic
1148027698 17:44600001-44600023 CTGGGCCATTGGCAAGTGCGAGG - Intergenic
1149016645 17:51916143-51916165 CAGTGTCATTGGCCAGAAGCTGG + Intronic
1152142945 17:78549172-78549194 CAGGGACCTTGGCAAGTGCTTGG + Intronic
1153902552 18:9630817-9630839 CAGTGTCCGTGGCAGCTGCCTGG - Intergenic
1160881942 19:1324962-1324984 CAGTGGCCTCGGCAAGTGCCCGG + Intergenic
1163067295 19:14807488-14807510 CAGTGTCATGTGCAAATCCCAGG - Intronic
1165950542 19:39471838-39471860 CAGTGTCATTGTCAGGTCCTTGG + Intronic
1166516709 19:43452610-43452632 CAGTGTCATTGGAATGTGAAAGG + Intergenic
1168559514 19:57371290-57371312 CAGTGTCATTGGCCTGTCCCTGG - Intronic
926269100 2:11351656-11351678 CAGTGTCAGTGGCAAGCCCTTGG + Intergenic
927113943 2:19883928-19883950 AAGTGTGATGGGCAAGAGCCAGG - Intergenic
927149923 2:20189651-20189673 AAGTGTTCTTGGAAAGTGCCAGG - Intergenic
928185749 2:29109135-29109157 CCGTTTCAGTGGCAAGTGCTGGG + Intronic
931721488 2:65070400-65070422 CAGTATCATTGGGAGGTGACCGG + Intronic
932686288 2:73873245-73873267 TCGTATCTTTGGCAAGTGCCTGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938941017 2:136169698-136169720 CAATGTCATTGGGAAGTTCAAGG - Intergenic
939956017 2:148528203-148528225 CAGTGACATTGGCGATAGCCAGG - Intergenic
941967706 2:171315946-171315968 CAGTGTCATTGGCAAGTGCCTGG - Intergenic
948335968 2:237207276-237207298 CAGTGTGATTGACAGGTGACAGG + Intergenic
1168859353 20:1034826-1034848 CAGTTTCATTGGGAAGTGGCAGG + Intergenic
1171277679 20:23872282-23872304 CAGTCTCATTGGCTAGGGCTGGG - Intergenic
1174097116 20:48098222-48098244 CAGTCTCATTGGCCAGAGCCTGG - Intergenic
1174585489 20:51604878-51604900 CACTGTCATGAGCCAGTGCCAGG + Exonic
1175153016 20:56949871-56949893 ACGTGTCATTGACATGTGCCTGG - Intergenic
1175218676 20:57404827-57404849 CAGAGGCATTGGCAGGTGCCAGG + Intronic
1176668834 21:9712882-9712904 CATTGTCAGTGGTAAGTACCAGG - Intergenic
1176866416 21:14057164-14057186 CAGTGTCCAAGGCCAGTGCCAGG + Intergenic
1179065595 21:38021593-38021615 CAGTGGCATTGGCATCTCCCAGG + Intronic
1179398403 21:41061896-41061918 CAGTGGACTTGGCAAGTGCACGG - Intergenic
1182960157 22:34464431-34464453 CAGTATCTTTAGTAAGTGCCTGG - Intergenic
1183332963 22:37231231-37231253 CAATCTCCTTGGCCAGTGCCAGG + Exonic
1184110521 22:42391309-42391331 CAGGATCATTGGCTACTGCCAGG + Intronic
953341273 3:42135980-42136002 CAGGGTCATTGGTGAGGGCCTGG - Intronic
954483367 3:50822843-50822865 AAGTGTCATTAGTAAGTGGCAGG - Intronic
959940546 3:112076608-112076630 CAGTGTCCTAAGCAAATGCCTGG - Intronic
961115613 3:124326647-124326669 CAATGTCACTGGCCAATGCCTGG - Intronic
961205296 3:125076670-125076692 CAATCTGATTGGCCAGTGCCTGG + Intergenic
969703031 4:8778056-8778078 CAGTGTGATTGGAAAGTGAATGG + Intergenic
970046538 4:11860849-11860871 CAGAGTCATAGGCAAGTACCAGG + Intergenic
972396009 4:38660500-38660522 CAGTGTCTTTTGCCAGTGACTGG - Intergenic
975941217 4:79648955-79648977 CAGTGTCATTGGCAAGAATCGGG + Intergenic
981551642 4:145947443-145947465 CAGTGGTTTTGGCCAGTGCCTGG - Intergenic
981858663 4:149327489-149327511 GAGTGGCTTTAGCAAGTGCCTGG + Intergenic
982673655 4:158350880-158350902 CAATGTCATTGGATAGTGCCTGG - Intronic
983156839 4:164358299-164358321 CAGTGACATTGGCAAGTTCAAGG - Intronic
984895272 4:184533529-184533551 CAGTGTCCTTGGGAAGTGGCCGG + Intergenic
985000576 4:185478429-185478451 CGGTATCATTGGCCAGAGCCTGG - Intergenic
985405950 4:189638643-189638665 CATTGTCAGTGGTAAGTACCAGG + Intergenic
988526381 5:31990862-31990884 CAGTGTCATGGGCAGGGGGCTGG + Intronic
990988299 5:61661189-61661211 CATGGTCACAGGCAAGTGCCAGG + Intronic
998819934 5:146049144-146049166 CAGGGTCCTGGGGAAGTGCCAGG + Exonic
999426662 5:151493404-151493426 CAGTGCCAATTGCAAGTACCAGG + Intergenic
1000172706 5:158718714-158718736 CAGTGTGATTTTCAAGAGCCAGG - Intronic
1001710920 5:173777360-173777382 CAGAGACACTGGAAAGTGCCAGG + Intergenic
1001817408 5:174681587-174681609 CAGTTTCATCAGCAATTGCCTGG - Intergenic
1002534348 5:179867966-179867988 CACTGTCATGGGCAGGTGCTGGG - Intronic
1006119479 6:31795420-31795442 CAGTGTCAGTGGGGAGTTCCTGG + Intronic
1007712488 6:43833612-43833634 CAGTTTAATTGGGAAGTGGCGGG + Intergenic
1007745652 6:44041473-44041495 CAGTGTCTTTTCCCAGTGCCTGG - Intergenic
1013690694 6:112638777-112638799 CAGTGTCTGTGTCAAGTGCTGGG - Intergenic
1016105635 6:140158772-140158794 CAGTGACATTGGGAATTGGCTGG + Intergenic
1016629392 6:146210629-146210651 CAGTGTCATGGGCAGGCTCCTGG - Intronic
1018228667 6:161655097-161655119 CAGCGTCATTAGCATGGGCCTGG + Intronic
1018228706 6:161655261-161655283 CAGCGTCATTAGCATGGGCCTGG + Intronic
1019288826 7:237147-237169 CAGCGTCATTGGAAAGCCCCAGG + Intronic
1021545990 7:21813215-21813237 CAGAGTCATAGGCAAGTTCAAGG + Intronic
1022329082 7:29360691-29360713 CAGCGTCATGGCCAAGTGCCTGG + Intronic
1022359943 7:29648320-29648342 CAGTGTCATTTGAAAATGGCAGG + Intergenic
1022368750 7:29750988-29751010 CAGTGTCATTTGAAAATGGCAGG + Intergenic
1023085338 7:36564669-36564691 TAATGTCATTGGCAATGGCCAGG - Intronic
1024501445 7:50112640-50112662 CAGTGCCTTTGGCCAGTGTCTGG - Intronic
1025186286 7:56862134-56862156 CAGGGGCAATGGAAAGTGCCAGG + Intergenic
1025685635 7:63714764-63714786 CAGGGGCAATGGAAAGTGCCAGG - Intergenic
1027539807 7:79453248-79453270 GAGTGTCATTGGCAGGAACCCGG - Exonic
1029105368 7:98170851-98170873 CAGTGTCATGGCCATGTGCTGGG + Intronic
1029622086 7:101696593-101696615 CATTCTCATTGACATGTGCCAGG + Intergenic
1029627899 7:101731829-101731851 CAGCGTCATTCGGAATTGCCAGG + Intergenic
1030299299 7:107959414-107959436 CAGTGGCACTGGCCAGTGACGGG + Exonic
1031025017 7:116671112-116671134 CATTATCATTTCCAAGTGCCTGG + Intergenic
1032491360 7:132326842-132326864 CAGTGTCTGTGCCCAGTGCCTGG + Intronic
1035890607 8:3338577-3338599 CACTGTTGTTGCCAAGTGCCTGG + Intronic
1036644873 8:10606755-10606777 CTGTGTCCTTGGCAAGTCCTTGG + Exonic
1037115422 8:15220425-15220447 GGGTGTCATTTGCAAGGGCCTGG - Intronic
1038609151 8:29043374-29043396 CAGTGTTGTTGGCAGGAGCCTGG - Intronic
1039039124 8:33390239-33390261 CAGTGTCACTGCAAAGTGCCTGG + Intronic
1040279910 8:46034924-46034946 CAGTCTCATTGGCATATGTCAGG - Intergenic
1041108334 8:54462614-54462636 CTGTGACATTACCAAGTGCCTGG + Intergenic
1044745347 8:95365535-95365557 GAGTTTAAATGGCAAGTGCCTGG + Intergenic
1049515262 8:143051135-143051157 CAGTGACATTGGGAAATGCAAGG + Intronic
1052019132 9:23505985-23506007 CAGGCACATTGGCACGTGCCTGG + Intergenic
1055908174 9:81317471-81317493 CAGAGGCAATGGCAAGTGCAGGG - Intergenic
1056715418 9:89024529-89024551 GAGTGTCATTAGCAGGTGGCAGG - Intronic
1061264074 9:129495695-129495717 CGGTGTACTTGCCAAGTGCCAGG - Intergenic
1062233373 9:135495777-135495799 CAGTGTTAACAGCAAGTGCCAGG - Intronic
1203657032 Un_KI270753v1:8059-8081 CATTGTCAGTGGTAAGTACCAGG + Intergenic
1203666387 Un_KI270754v1:22845-22867 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203667537 Un_KI270754v1:28484-28506 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203668685 Un_KI270754v1:34123-34145 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1187227491 X:17387614-17387636 GAGTAACATTGGCAAGTGTCTGG + Intronic
1189960333 X:46318519-46318541 CAGTTTAATTTGCAAGTCCCAGG + Intergenic
1194757708 X:97757247-97757269 CAGAGTCATTAGCAAGTACAAGG - Intergenic
1196752085 X:119127133-119127155 TTGTGTCATTGGTAAGTTCCTGG + Intronic
1197692348 X:129515384-129515406 CAGTGTGGTGGGCACGTGCCTGG + Intronic
1197892239 X:131279056-131279078 CAGTGTCATTGGCCAGGGAGTGG - Intronic
1200915357 Y:8566653-8566675 CAATGTCAATGGCAAGTCCAAGG - Intergenic
1201310912 Y:12597547-12597569 GGATGTCATTGGCATGTGCCTGG + Intergenic