ID: 941978652

View in Genome Browser
Species Human (GRCh38)
Location 2:171432123-171432145
Sequence GCCCAGTGGGCCAGTTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941978642_941978652 27 Left 941978642 2:171432073-171432095 CCCACAGTCAGGTGGCCACAGGA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 941978652 2:171432123-171432145 GCCCAGTGGGCCAGTTGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 206
941978646_941978652 3 Left 941978646 2:171432097-171432119 CCACACCTGCGTGCAAGCCAGGA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 941978652 2:171432123-171432145 GCCCAGTGGGCCAGTTGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 206
941978643_941978652 26 Left 941978643 2:171432074-171432096 CCACAGTCAGGTGGCCACAGGAT 0: 1
1: 0
2: 1
3: 9
4: 183
Right 941978652 2:171432123-171432145 GCCCAGTGGGCCAGTTGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 206
941978644_941978652 12 Left 941978644 2:171432088-171432110 CCACAGGATCCACACCTGCGTGC 0: 1
1: 0
2: 1
3: 7
4: 118
Right 941978652 2:171432123-171432145 GCCCAGTGGGCCAGTTGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 206
941978648_941978652 -2 Left 941978648 2:171432102-171432124 CCTGCGTGCAAGCCAGGAGTGGC 0: 1
1: 0
2: 3
3: 10
4: 136
Right 941978652 2:171432123-171432145 GCCCAGTGGGCCAGTTGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941978652 Original CRISPR GCCCAGTGGGCCAGTTGTGC AGG Intronic
901316890 1:8315669-8315691 GCCCACGGGGCCAGGTGTGCAGG - Intergenic
901931582 1:12599333-12599355 GCCCATAGGGCCAGTTGAGGCGG + Intronic
902642402 1:17775251-17775273 GCCCAGGGGTCCAGCTGGGCAGG + Intronic
903220346 1:21865750-21865772 GCCCTGTGGGCCTGCTGTGTAGG + Exonic
903458560 1:23505142-23505164 GCCCAGTGTGGCAATGGTGCTGG + Intergenic
904771691 1:32884671-32884693 GCCTGGGGGGCCAGCTGTGCTGG - Intergenic
908050174 1:60220860-60220882 GCTTAGTATGCCAGTTGTGCAGG + Intergenic
912978954 1:114353412-114353434 GGGCAGTGGGCCAGCTGTGGGGG + Intergenic
917544267 1:175946875-175946897 GCCCTGTGGGAGAGTTGTACTGG + Intronic
920019297 1:202942118-202942140 CCACAGTGGGCCAGATGGGCTGG - Exonic
922460822 1:225813295-225813317 GCCCAGGGGGCCAGCTGGGCTGG - Intronic
923405854 1:233659280-233659302 TTCCAGTGGGACAGATGTGCGGG - Intronic
1064041536 10:11969732-11969754 GCACTGTGGACCAGTTTTGCTGG + Intronic
1064278399 10:13928789-13928811 GCCCACTGGGCCGTCTGTGCTGG - Intronic
1064706460 10:18077508-18077530 CCCAAGTGGGCCAGGTGTGGTGG + Intergenic
1065085011 10:22165241-22165263 CCACAGTGGGCCAGATGGGCTGG + Intergenic
1065426850 10:25615181-25615203 CCCCAGTGGGCCTGTAGTGGTGG - Intergenic
1067024207 10:42829524-42829546 CCAGAGTGGGCCAGTTGTGGTGG + Intronic
1070459359 10:76649256-76649278 GCCCAGTGGGCCAAATCTGCAGG + Intergenic
1070931211 10:80261738-80261760 GCCCAGTAAGCCAGATGCGCTGG + Intergenic
1071850373 10:89562766-89562788 TCCTAGTGGGCCAATTGTGAGGG + Intergenic
1072204221 10:93188170-93188192 GCCCATTGGGCTGGTTGTCCAGG - Intergenic
1072230411 10:93409656-93409678 GCCCAAGGGGCCAGTTGGGACGG - Exonic
1073192409 10:101661199-101661221 GACAAGTGGGCCAATCGTGCTGG + Intronic
1075464626 10:122642354-122642376 GGCCAGTGGGCCAGTTTTCCTGG + Intronic
1076379241 10:130014001-130014023 CCCCAGTGGGGCAGCTGTGCTGG - Intergenic
1076923734 10:133470181-133470203 GCCCAGAGTCCCAGCTGTGCGGG - Intergenic
1080801183 11:35611775-35611797 TCCCAGTAGCCCAGTTGTGATGG + Intergenic
1082231067 11:49767203-49767225 GAACAGTGGGCCAGGTGTGGTGG + Intergenic
1083894544 11:65613576-65613598 GCCCAGTGGGCAGGATGAGCTGG - Exonic
1086249697 11:84798452-84798474 GCCCCATGGGCCAGTGGTGGTGG - Intronic
1086272104 11:85079915-85079937 ACCTAGTGGGCCAGGTGTGGTGG - Intronic
1087380413 11:97398418-97398440 TCCCAGTGGGCCTGTGGTGGTGG - Intergenic
1088009858 11:104986686-104986708 GCCCCATGGGCCTGTGGTGCTGG + Intergenic
1088606700 11:111540371-111540393 GCCAAGTTCGCCAGCTGTGCGGG - Intronic
1089053259 11:115564450-115564472 CCCCAGTGGGCCTGTTCTTCAGG - Intergenic
1089115783 11:116093900-116093922 GGGCAGTGGGCCATTTATGCAGG + Intergenic
1089477447 11:118776545-118776567 CCTCAGTGGGCCAGGTGTGTTGG + Intronic
1091004874 11:131943557-131943579 GACCAGTGGGGCAGGTGTACAGG + Intronic
1091874878 12:3925397-3925419 GCCTTGAGGGACAGTTGTGCCGG + Intergenic
1092275282 12:7056135-7056157 GTCCTGTGGGCCAGGTGTGGTGG - Exonic
1092530271 12:9338392-9338414 GTCCTGTGGACAAGTTGTGCAGG - Intergenic
1092911724 12:13151638-13151660 GCTCAGTGGCCCAGTGGGGCAGG - Intergenic
1093024673 12:14234953-14234975 GCCCAGTTGGCCTGTAGAGCGGG - Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094131291 12:27078615-27078637 ACACAGTGGGCCAGTTGCGGTGG - Intergenic
1096669925 12:53192496-53192518 GGCCAGTGGGCCAGTCCTGAAGG + Exonic
1097573822 12:61365597-61365619 GACCAGTGGCCCAGTGGAGCAGG - Intergenic
1099608908 12:84839868-84839890 CACCAGTGGGCCAGTCGTGGTGG - Intergenic
1100649815 12:96573078-96573100 GGCCAGTGGGCCAGTGCTGCTGG + Intronic
1102584283 12:113912254-113912276 AGCCAGTGGGACAGGTGTGCAGG - Intronic
1104419272 12:128621722-128621744 TCCCAGTGGGACAGGTGTGTGGG - Intronic
1104426100 12:128679410-128679432 CCTCAGTGTGCCAGTTGTGTGGG + Intronic
1104927215 12:132319996-132320018 ACCCAGTGGCCCAGTGGTTCTGG - Intronic
1104963257 12:132498070-132498092 GCCCTGTGGGCCAGCTCTCCCGG - Intronic
1104978951 12:132564422-132564444 GCCCAGAGGGGCACTGGTGCTGG - Intronic
1104993803 12:132641894-132641916 GCCCAGGGGGCTGGTGGTGCTGG - Intronic
1105525365 13:21173147-21173169 GAGCTGAGGGCCAGTTGTGCAGG - Intronic
1106105260 13:26727521-26727543 TTCCAGTGGGCCAGTTTTGTTGG + Intergenic
1112398528 13:99055543-99055565 GCGCACAGGGTCAGTTGTGCAGG + Intronic
1113066090 13:106375337-106375359 GCCCTGTGAGCCAGTCCTGCGGG + Intergenic
1113246410 13:108401767-108401789 CCCCAGAGGGCCAGTTGCTCAGG + Intergenic
1113457807 13:110461406-110461428 GCCCAATGGTGCAGATGTGCAGG - Intronic
1113866135 13:113526430-113526452 GCACAGTTGGCCAGGTGTGGTGG + Intronic
1115282339 14:31678080-31678102 GCCCTGTGGGTCTGTAGTGCTGG - Intronic
1116220854 14:42085520-42085542 TCCCAGTGGGCCTGTGGTGATGG - Intergenic
1119828685 14:77680961-77680983 GAGTAGTGGGCCAGTTGTGGTGG - Intronic
1121050641 14:90816871-90816893 GACCAGTGAGCCAGGTGTGAGGG + Intergenic
1121528243 14:94634284-94634306 CCACAGTGGGCCAGATGGGCTGG + Intergenic
1122581310 14:102773418-102773440 GCACAGTGGGGCAGCTGGGCTGG - Intergenic
1122607053 14:102953705-102953727 GCCCAGTGGGGCCGCTGTGCTGG + Intronic
1202868160 14_GL000225v1_random:136190-136212 GCCCTGTGGCCCTGTTGAGCTGG + Intergenic
1123438717 15:20274301-20274323 GCACAGTAGGCCAGGTGTGGTGG + Intergenic
1128003575 15:64217225-64217247 GAAAAGAGGGCCAGTTGTGCTGG - Intronic
1128162625 15:65434271-65434293 GCCCATTGTGCCAGATGTGCAGG - Intergenic
1129270405 15:74416575-74416597 CCCGTGTGGCCCAGTTGTGCAGG - Exonic
1130546307 15:84859366-84859388 GCCCAGTGGGCGAGGTGGGCAGG + Exonic
1130871846 15:87978061-87978083 GCCCCATGGGCCAGTGGAGCTGG + Intronic
1137754327 16:50889443-50889465 GCCCAGTGGGCCGGTAAGGCTGG + Intergenic
1139919993 16:70453800-70453822 TCCTAGTGGGCAAGTTGTGAGGG + Intergenic
1141588457 16:85050866-85050888 ACCCAGTGGGCCAGGTGCACTGG + Intronic
1142225766 16:88876991-88877013 GTCCAGTGGGCCAGGTGGGCTGG + Exonic
1142658535 17:1411149-1411171 GTCCAGAGGGCCGGGTGTGCTGG - Intergenic
1143457822 17:7079086-7079108 ACCCAGTGGGCCAGTTAATCAGG + Intronic
1143754300 17:9055314-9055336 GTCCAGTGGTGCAGTGGTGCAGG - Intronic
1144273787 17:13645208-13645230 GCCAAGTAGGGCAGTTATGCTGG - Intergenic
1146149388 17:30453928-30453950 GCCCTGTGTCCCAGCTGTGCCGG - Intronic
1146937974 17:36824291-36824313 GCCCTGTGAGCCAGGTGTCCTGG - Intergenic
1151204193 17:72493405-72493427 GCCAAGAGGGCCAGGTGTGGAGG + Intergenic
1152705406 17:81841095-81841117 ACCCTGTGGACCAGCTGTGCGGG - Intergenic
1159780785 18:72658356-72658378 GTTCAGCGGGCCAGTTGTGGTGG + Intergenic
1160788249 19:911917-911939 GCCCAGAGGGCGAGTGGGGCCGG + Intronic
1161244735 19:3243567-3243589 GTCCACTGGGCCAGGTGTGGTGG - Intronic
1161696442 19:5771215-5771237 GCCCTGGGGGCCAGTGGGGCTGG - Intronic
1162585174 19:11553931-11553953 ACACAGTGGGCCAGATGAGCAGG + Intronic
1163567443 19:18059863-18059885 GCCCAGTGGGCCAGACGGTCAGG - Intronic
1165069479 19:33247412-33247434 GCCCAGGAGGCCAGCTGTGGTGG + Intergenic
1165434748 19:35789709-35789731 TAGCAGTGGGACAGTTGTGCAGG + Intergenic
1166704937 19:44903383-44903405 GCCCAGTGGGCCTGGGGTCCCGG + Exonic
1166726643 19:45032482-45032504 GCACAGTGGTCCAGATGTCCTGG + Intronic
1167202337 19:48074670-48074692 CCCCTGTGGGCCAGTCCTGCAGG - Intronic
1167321481 19:48799633-48799655 GCCCAGTGCGCCAGTCGTTCTGG + Intronic
925362436 2:3288909-3288931 GCCCAGGGGGCCAGGGCTGCTGG - Intronic
925927232 2:8679118-8679140 CCCCATTGCGCCAGATGTGCAGG + Exonic
926254328 2:11177039-11177061 GTCCTGTGGGCCAGTTTTTCAGG + Intronic
928288152 2:30011253-30011275 AGCCAGTGGGACAGTTATGCTGG + Intergenic
929570437 2:43019519-43019541 GGCCAGAGGGCCAGGTGTGGTGG - Intergenic
929977709 2:46651517-46651539 GCCCAGTGGGTCATGTGTGAAGG + Intergenic
931367945 2:61635751-61635773 GAGCAGTGGGCCATTTCTGCAGG + Intergenic
933811566 2:86035932-86035954 GACCAGTGTGCCAGTTTTCCTGG + Intronic
934991163 2:98922541-98922563 GCCCAGTGGGCCAGCTGGCCTGG + Intronic
935712030 2:105907997-105908019 CCCCACTGGGACAGTTGGGCTGG + Intergenic
939558097 2:143701444-143701466 ACCCAGTGGGCCAGGCGTGGTGG + Intronic
941298143 2:163766430-163766452 ACCCAGTGGGCTAGGTGTTCTGG + Intergenic
941978652 2:171432123-171432145 GCCCAGTGGGCCAGTTGTGCAGG + Intronic
944568249 2:201013693-201013715 GCACAGTGGCCCAGATGTGGTGG - Intronic
1168779764 20:478639-478661 CCCTAGTGGGCCAGGTGTGGTGG + Intronic
1168811132 20:705351-705373 GCACAGTGGGCCAGGTGTGGTGG - Intergenic
1168849684 20:967989-968011 ACCCAGGGGGACAGTCGTGCAGG + Exonic
1169831567 20:9831046-9831068 GCCCAGTGGGCTGGGTGTGGGGG + Intronic
1169917978 20:10702693-10702715 GCTCAGTTGGGCAGTTCTGCTGG - Intergenic
1170129674 20:13005561-13005583 GCAGTGTGGGCCAGGTGTGCTGG - Intergenic
1170787758 20:19482205-19482227 GCCAGGTGGGCCAGGTGGGCTGG - Intronic
1170816003 20:19714961-19714983 GCTCAGAGGGCAAGCTGTGCTGG + Intronic
1173250401 20:41361420-41361442 GCTCAGTGGGCAAGCTGTCCAGG + Exonic
1174334528 20:49849492-49849514 GCACGGAGGGCCAGGTGTGCAGG + Intronic
1174655549 20:52169417-52169439 GCACAGGGGGTCACTTGTGCAGG - Intronic
1175153302 20:56952330-56952352 GCCCAGTGCCTCAGTTATGCTGG - Intergenic
1175187802 20:57190552-57190574 GCCCAGTGGGGGATTTGGGCAGG + Intronic
1176018921 20:62952876-62952898 ACCCAGTGGTCCAGGTGTGGCGG + Exonic
1176025292 20:62982468-62982490 GCCCAAGGGGCCAGGAGTGCAGG + Intergenic
1177212881 21:18091815-18091837 GCCCCGTGGACCAGTAGTGGTGG + Intronic
1179119414 21:38529079-38529101 GCAGAGTGAGCCAGTGGTGCTGG + Intronic
1179884850 21:44309525-44309547 GGCCAGTGGCTCAGTTCTGCTGG - Intronic
1180160411 21:45996637-45996659 GCCAGGTGGGCCAGGTGGGCCGG + Intronic
1180697137 22:17758943-17758965 GCCAGGTGGGCCAGGTGTGGTGG + Intronic
1181457415 22:23067526-23067548 GCCCAGTGGGCCAGGAGTTCAGG - Intronic
1182900024 22:33890043-33890065 AGCCAGTGGGCCAGCTGGGCTGG - Intronic
1183224210 22:36538163-36538185 GGCCAATGGGCCAGTTGCGGTGG - Intergenic
1184419948 22:44373918-44373940 GCCAAGGGGGACAGATGTGCTGG + Intergenic
1184546312 22:45171135-45171157 GTACAGTGGGCAAGTTGGGCAGG + Intronic
1184764174 22:46563025-46563047 CCACAGAGGGCCAGGTGTGCTGG - Intergenic
950139783 3:10607514-10607536 GGCCAGGGTGCCAGGTGTGCAGG - Intronic
950884240 3:16348802-16348824 TCCCAGTGGGGCAGGTGGGCTGG - Intronic
952297489 3:32074096-32074118 GCCCAGTCGGCCTGTAGAGCGGG - Intronic
954781040 3:53060642-53060664 CACCAGGGGGCCAGTTGTGGTGG - Intronic
959597589 3:108144873-108144895 GCCAAGTGGGTCAGTTGCGATGG + Intergenic
961439551 3:126944802-126944824 GCCCAGTGGCCCAGGCGTGGGGG + Intronic
963042660 3:141080920-141080942 GCCCACTGGGCCAGGTTTCCTGG - Intronic
964179450 3:153865691-153865713 GCCCCATGGGCCAGTGGTGGTGG + Intergenic
965429490 3:168568741-168568763 GGCCAGGGGGCCAGGTGTGGTGG - Intergenic
966503440 3:180672304-180672326 GCTCATTGGGCCAGGTGTGGTGG + Intronic
969016320 4:4106615-4106637 GCTCAGGGGCCCAGGTGTGCAGG + Intergenic
969571217 4:8009681-8009703 GCCAAGTGGGCCAGGTGCGGTGG - Intronic
971634173 4:29034809-29034831 GGCCAGTGGGTCAGTTTTGATGG + Intergenic
979045337 4:115855852-115855874 GCTCAGTAGGCCAGGTGTGGTGG + Intergenic
983094952 4:163550546-163550568 TCCCAGCCGGCCAGGTGTGCAGG + Intronic
985344562 4:188989221-188989243 GCACATTGGGCCAGGTGTGGTGG - Intergenic
985678723 5:1245200-1245222 ACCCAGTGGGTCAGTTTGGCTGG + Intronic
985777293 5:1851467-1851489 CCCCAGGGGGCCAGGTGTGGTGG - Intergenic
990700274 5:58467410-58467432 TCCTAGTGGGCCAATTGTGAGGG - Intergenic
990884793 5:60579356-60579378 GCACAGTGGGCCAGCGGTGTGGG + Intergenic
991588497 5:68223960-68223982 ACCCAGTGGGCCAGTTTGGTGGG - Intronic
998250755 5:140550600-140550622 GCCCAGTGGGACAGTCTTGGTGG + Exonic
1000350817 5:160351035-160351057 GCACTGTGGGCCAGGTGTGGTGG - Intronic
1003045542 6:2729868-2729890 GCCCAGTGGCCCAGCTGGGAGGG - Intronic
1003108739 6:3235638-3235660 GACTAGTGGGCCAGTTGGGGTGG - Intronic
1003173726 6:3739477-3739499 GCCCAGGCGGCCAGCTGTGCAGG + Intronic
1006513551 6:34534085-34534107 GCCCAGGAGGCCAGGTGTGCAGG - Exonic
1008483537 6:52010923-52010945 GACCAGTTAGCCAGTTGTGTGGG - Intronic
1011246432 6:85325745-85325767 GGCAAGTGGGCCAGGTTTGCTGG - Intergenic
1011615703 6:89196481-89196503 TCTCAGTGGGCCAGGTGTGGTGG + Intronic
1012433759 6:99193107-99193129 GCCCAGCAGTCCAGTTGTGTTGG - Intergenic
1013238875 6:108224565-108224587 GCTAAGTGGGCCAGGTGTGGTGG - Intronic
1013950218 6:115771190-115771212 GGCCAGTGTGACAGTTGTTCTGG + Intergenic
1014666713 6:124246896-124246918 GCCCAGTGGGACACCTGTGTTGG - Intronic
1015319955 6:131861880-131861902 GACAAGTGGGCCAGCTGTGGTGG + Intronic
1015402349 6:132800401-132800423 CCCCAGTGGGCAAGTTGTAAAGG + Intergenic
1016937061 6:149455317-149455339 CCCCTGTGGGCCAGGCGTGCTGG + Intronic
1019351409 7:555820-555842 GGCCTGTGAGCCAGGTGTGCTGG - Intronic
1021513798 7:21461421-21461443 CGCCAGTGGGCCAGTACTGCTGG + Intronic
1022490371 7:30813041-30813063 CCCCAGTGGAACAGATGTGCAGG - Intronic
1022590123 7:31653586-31653608 TCCCAGTGGGCAAATTGTGAGGG + Intronic
1022976871 7:35566795-35566817 GACCAGTTAGCCATTTGTGCTGG - Intergenic
1024551734 7:50567789-50567811 GCCCAGAGGGCCAGTAAAGCAGG - Intergenic
1025110688 7:56213716-56213738 GCCCAGAGGGCCAGTGGATCTGG + Intergenic
1026128244 7:67598284-67598306 ACACAGTGGGCCAGTTGCCCCGG - Intergenic
1026307234 7:69152706-69152728 GCCCAGAGGGCCAGTGGATCTGG - Intergenic
1028949541 7:96619602-96619624 GAGCAGTGGGCCAGTTATGTGGG + Intronic
1029338020 7:99919072-99919094 GGCCAGTGTGCCTGGTGTGCAGG - Exonic
1031965966 7:128028785-128028807 GTCCAGTGGGCCCCATGTGCTGG + Exonic
1032450417 7:132025690-132025712 TACCAGTGGGCCAGGTGTGGTGG - Intergenic
1033322663 7:140353995-140354017 GCTAAGTGGGCCAGGTGTGGTGG - Intronic
1034211891 7:149371077-149371099 CTTCAGTGGGCCAGTTCTGCAGG + Intergenic
1035476985 7:159150775-159150797 ACCCAGAGGCCCAGGTGTGCCGG + Intergenic
1036143566 8:6230471-6230493 ACCCACTGGGCCAGTTCTCCTGG - Intergenic
1042110439 8:65375926-65375948 GCCCAGTAGTCCAGTAGTTCTGG - Intergenic
1045291196 8:100834223-100834245 TACCAGTGGGCCAGATGTGGTGG + Intergenic
1048498910 8:134958260-134958282 CCCCAGTGGGCCAGGTGTGGTGG + Intergenic
1049209376 8:141378497-141378519 GCCCAGTGGACCAGCAGAGCAGG + Intergenic
1049733515 8:144191466-144191488 GCCCAGAGGCCCAGTGCTGCTGG + Intronic
1049979370 9:890274-890296 GCCCAGTGGGGAAGTTGAGGAGG + Intronic
1052031716 9:23636635-23636657 TCCCATTAGGCCAGGTGTGCTGG + Intergenic
1055067293 9:72131592-72131614 GAGAAGTGGGCCATTTGTGCAGG - Intronic
1056825792 9:89875579-89875601 CCCCAGCGTGCCAGCTGTGCAGG + Intergenic
1057885090 9:98823799-98823821 GCTCACTGAGCCAGCTGTGCGGG + Intronic
1058723490 9:107780097-107780119 GTCCAGGGTGCCAGATGTGCTGG - Intergenic
1061048865 9:128182426-128182448 CCCCACTGGGCCAGGTGTGGTGG - Intronic
1062233692 9:135497952-135497974 GCCCAGTGTCCCAGGTGTGCAGG + Intronic
1062505157 9:136870157-136870179 GCTCAGTGGGCCAGATGTGGTGG - Intronic
1062675842 9:137743231-137743253 GGGCAGTGGGCCTGTTGTGATGG + Intronic
1203736617 Un_GL000216v2:144078-144100 GCCCTGTGGCCCCGTTGAGCTGG - Intergenic
1188917818 X:35934335-35934357 TCCCTGTGGGCCAGTGGTGGTGG - Intronic
1192175401 X:68881856-68881878 ACCCAGTGGCCCAGATGGGCTGG + Intergenic
1192522374 X:71814278-71814300 TCCCAGTGGGAGAGGTGTGCTGG + Intergenic
1192763906 X:74123649-74123671 GCCCAGTCGGCCTGTAGAGCGGG + Intergenic
1195155212 X:102115983-102116005 GCCCAGTGGTCCACTTCTGTGGG + Intergenic
1195826686 X:109009972-109009994 GCCTACTGGGCCAGCTCTGCTGG + Intergenic
1195971469 X:110478060-110478082 GCCCTGTGGGCCAGTGGTGGCGG - Intergenic
1196641574 X:118068691-118068713 GCCCTGTGGGCCACTTGGGGTGG - Intronic
1197892115 X:131278470-131278492 GCCCAGTGAGGCACTTGAGCTGG - Exonic
1198558000 X:137816363-137816385 GCCCTGTGGGCCAGGTGCGGTGG - Intergenic
1199353459 X:146832207-146832229 GCCCAGTGGGTCAGGTGGGCAGG + Intergenic
1201284495 Y:12367751-12367773 GCCCAGGGGGCCAGGTGCGGTGG + Intergenic
1202272653 Y:23085946-23085968 CACCAGTGGGCCAGCCGTGCTGG + Intergenic
1202293373 Y:23334736-23334758 CACCAGTGGGCCAGCCGTGCTGG - Intergenic
1202425650 Y:24719690-24719712 CACCAGTGGGCCAGCCGTGCTGG + Intergenic
1202445139 Y:24950395-24950417 CACCAGTGGGCCAGCCGTGCTGG - Intergenic