ID: 941981612

View in Genome Browser
Species Human (GRCh38)
Location 2:171464451-171464473
Sequence TTGAAGACACAGAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941981612_941981615 -3 Left 941981612 2:171464451-171464473 CCTTTCTCCCTCTGTGTCTTCAA No data
Right 941981615 2:171464471-171464493 CAAATCTCTTTCTCCTTATAAGG No data
941981612_941981617 18 Left 941981612 2:171464451-171464473 CCTTTCTCCCTCTGTGTCTTCAA No data
Right 941981617 2:171464492-171464514 GGACACCAGTCATTGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941981612 Original CRISPR TTGAAGACACAGAGGGAGAA AGG (reversed) Intronic
No off target data available for this crispr