ID: 941981615

View in Genome Browser
Species Human (GRCh38)
Location 2:171464471-171464493
Sequence CAAATCTCTTTCTCCTTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941981612_941981615 -3 Left 941981612 2:171464451-171464473 CCTTTCTCCCTCTGTGTCTTCAA No data
Right 941981615 2:171464471-171464493 CAAATCTCTTTCTCCTTATAAGG No data
941981608_941981615 25 Left 941981608 2:171464423-171464445 CCAAATTCTGCCTCTCACTTTTC No data
Right 941981615 2:171464471-171464493 CAAATCTCTTTCTCCTTATAAGG No data
941981611_941981615 3 Left 941981611 2:171464445-171464467 CCATGGCCTTTCTCCCTCTGTGT No data
Right 941981615 2:171464471-171464493 CAAATCTCTTTCTCCTTATAAGG No data
941981613_941981615 -10 Left 941981613 2:171464458-171464480 CCCTCTGTGTCTTCAAATCTCTT No data
Right 941981615 2:171464471-171464493 CAAATCTCTTTCTCCTTATAAGG No data
941981610_941981615 15 Left 941981610 2:171464433-171464455 CCTCTCACTTTTCCATGGCCTTT No data
Right 941981615 2:171464471-171464493 CAAATCTCTTTCTCCTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941981615 Original CRISPR CAAATCTCTTTCTCCTTATA AGG Intronic
No off target data available for this crispr