ID: 941981617

View in Genome Browser
Species Human (GRCh38)
Location 2:171464492-171464514
Sequence GGACACCAGTCATTGAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941981614_941981617 10 Left 941981614 2:171464459-171464481 CCTCTGTGTCTTCAAATCTCTTT No data
Right 941981617 2:171464492-171464514 GGACACCAGTCATTGAATTTAGG No data
941981613_941981617 11 Left 941981613 2:171464458-171464480 CCCTCTGTGTCTTCAAATCTCTT No data
Right 941981617 2:171464492-171464514 GGACACCAGTCATTGAATTTAGG No data
941981611_941981617 24 Left 941981611 2:171464445-171464467 CCATGGCCTTTCTCCCTCTGTGT No data
Right 941981617 2:171464492-171464514 GGACACCAGTCATTGAATTTAGG No data
941981612_941981617 18 Left 941981612 2:171464451-171464473 CCTTTCTCCCTCTGTGTCTTCAA No data
Right 941981617 2:171464492-171464514 GGACACCAGTCATTGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941981617 Original CRISPR GGACACCAGTCATTGAATTT AGG Intronic
No off target data available for this crispr