ID: 941983390

View in Genome Browser
Species Human (GRCh38)
Location 2:171485353-171485375
Sequence CAGCAGTTCCTGGGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 462}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941983390 Original CRISPR CAGCAGTTCCTGGGGAAGGA AGG (reversed) Intergenic
900619435 1:3580201-3580223 GGGCATTTCCTGGGGAAGGTGGG + Intronic
900858387 1:5204772-5204794 CCGCCTTTCCTGGGGTAGGAGGG + Intergenic
900939475 1:5788920-5788942 CAGCACTTCCAGGGGAAAGCAGG + Intergenic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
901959175 1:12810818-12810840 CAGCAGAGCCTGGGAAGGGATGG + Intergenic
902242821 1:15100178-15100200 CAGGAGTGCCTGGAGAAAGAGGG + Intronic
902460926 1:16576114-16576136 CAGGACTTCCTGGGTAAGAACGG - Intronic
902583861 1:17426166-17426188 CAGGAGAGCCTGGGAAAGGAGGG - Intronic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
902721157 1:18305082-18305104 CTGAAGTTCCTGGGAAAGTAAGG + Intronic
902737412 1:18410360-18410382 CAGCACTGCCTGGGGATGCAGGG - Intergenic
904586473 1:31583732-31583754 CAGCACATCCTGTGGAAGCAGGG - Intronic
904678426 1:32212614-32212636 CAGCAGCCCCTGGGCAGGGAGGG - Exonic
905519325 1:38586073-38586095 AAGAAATTCCTGAGGAAGGAGGG - Intergenic
905557656 1:38899870-38899892 CTGCCCTTCCTGGGGCAGGAGGG + Intronic
906115271 1:43352465-43352487 AAGCAGATCCTGTGGGAGGAGGG - Intronic
907369462 1:53991508-53991530 CTGCATTTCCTGGAGAGGGATGG - Intergenic
907495735 1:54843104-54843126 TAACAATCCCTGGGGAAGGAGGG - Intergenic
907496139 1:54846031-54846053 CAGCAATCCCTGGAGAAGGAGGG + Intergenic
907866919 1:58407476-58407498 CAGCATTGCCTGGGGAAAGGGGG - Intronic
908050727 1:60227043-60227065 CAGCAGCTACTGAGGAAAGAAGG + Intergenic
908313974 1:62914695-62914717 CAGCAAGTCCTGAGGCAGGATGG + Intergenic
908384514 1:63628254-63628276 TACCATTTCCTGGGGAAGGCAGG + Intronic
909038756 1:70625575-70625597 AAACAGTTCCTGGGCAAGGAGGG + Intergenic
909643022 1:77888308-77888330 CAGCCAGGCCTGGGGAAGGAAGG - Intergenic
910449617 1:87331900-87331922 CAGCAGCTCCGCGGGGAGGAGGG + Intronic
911272175 1:95815498-95815520 CAGGAGAGCCTGGAGAAGGAAGG + Intergenic
912724734 1:112048908-112048930 CAGAAGTTCCTGGTAAAGTAAGG + Intergenic
912748027 1:112262094-112262116 CAGCAATTCTTGTGGAAGGAGGG - Intergenic
913513078 1:119580386-119580408 GTGCAGTGGCTGGGGAAGGAGGG - Intergenic
914364929 1:146969727-146969749 CAGGACTTCCTGGGTAAGAACGG + Intronic
914365690 1:146976022-146976044 CAGGACTTCCTGGGTAAGAACGG + Intronic
914486753 1:148117419-148117441 CAGGACTTCCTGGGTAAGAACGG - Intronic
914513185 1:148352439-148352461 CAGAGGTTCCTGGGGAAGTTAGG - Intergenic
915113652 1:153581626-153581648 CAGCTGTTCTTGGGAAGGGACGG + Intergenic
915520519 1:156439757-156439779 CTTCAGCTCCTGGGGAGGGAGGG - Intergenic
915665314 1:157439153-157439175 CAGAAGGTGATGGGGAAGGAAGG + Intergenic
915671413 1:157491893-157491915 CAGAAGGTCCAGGGGAAAGAAGG - Intergenic
915870727 1:159557118-159557140 GAGCTGCTGCTGGGGAAGGAAGG - Intergenic
916234409 1:162571927-162571949 CAGCAGTTCCTGGAGAATCAAGG - Intronic
916399756 1:164434037-164434059 CAGGAATTCATGGGGAATGATGG - Intergenic
917120465 1:171640886-171640908 CAGCAGTTGTTGGGTGAGGAAGG + Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
919124810 1:193381126-193381148 GAGGTCTTCCTGGGGAAGGATGG + Intergenic
919814650 1:201429835-201429857 CAGCAGGCCCCAGGGAAGGACGG - Intronic
920082333 1:203384052-203384074 CAGCAGTTCAGGGGGAATAAAGG - Intergenic
920380418 1:205531756-205531778 AGGCAGGTCCTGGGGGAGGAGGG - Exonic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
922155457 1:223037216-223037238 CAGCAAATCATGGGCAAGGAGGG + Intergenic
922237666 1:223734089-223734111 CAGCAGCTCCTGGGAGAGGCTGG - Intronic
922575545 1:226658801-226658823 CAGCAGTTGCTTCTGAAGGAGGG - Intronic
923648902 1:235853525-235853547 CAGTAGTTCTGGGGGAAGAATGG + Intronic
1063458365 10:6201072-6201094 CCGCGGTTCCTGGGGAATGACGG - Intronic
1063566346 10:7174727-7174749 CAGCAGCTCCTGAGTAAGAAAGG - Intronic
1066094175 10:32056588-32056610 CAGAAGTTCCTGGGGAGGCAGGG + Intergenic
1067350565 10:45472116-45472138 CACCAGTTGCCGGGAAAGGAGGG - Intronic
1067686159 10:48466924-48466946 AAGCAGGTCCTGGGCAAAGAGGG - Intronic
1068985857 10:63107065-63107087 AACCAAATCCTGGGGAAGGAGGG + Intergenic
1069419340 10:68232210-68232232 CCGCAGTTCCCAGGGTAGGAAGG - Intergenic
1070140740 10:73735223-73735245 CAGCAGTTGGTGGGGACAGAGGG - Intergenic
1071251479 10:83823968-83823990 CTGGAGAGCCTGGGGAAGGAAGG - Intergenic
1072610397 10:97013981-97014003 CAGCAGTGTCTGGGGGAGGTGGG - Intronic
1073076737 10:100829057-100829079 CAGCACGTCCTGGGGGAGGGGGG + Exonic
1073134914 10:101215142-101215164 CTCCAGGTCCTGGGGAAGGCCGG - Intergenic
1073568745 10:104558050-104558072 CTGCAGGTGCTGGTGAAGGATGG + Intergenic
1074434683 10:113424088-113424110 CTGCAGGTGCTGGGGAAGGCTGG + Intergenic
1075576395 10:123580692-123580714 CAGCAGGACCTGGTGAAGGCTGG - Intergenic
1075614639 10:123882607-123882629 CACCATTTTCTGGGGAAGGCTGG - Intronic
1075980730 10:126736967-126736989 AAGCAGCTCCTGGAGAAGGAAGG - Intergenic
1076215084 10:128686969-128686991 CATCAGTGCCTGTGGAAGGAAGG + Intergenic
1076271941 10:129161359-129161381 CAGCAATTCCTGGGGTGGGGAGG - Intergenic
1076464413 10:130668756-130668778 CAGTCCTTCCTGGGGAAGAAGGG - Intergenic
1076586190 10:131549264-131549286 CAGCAGGTCCTGGGGCAGATGGG - Intergenic
1077164515 11:1129094-1129116 GGGCAGTTCCCAGGGAAGGAGGG + Intergenic
1077663694 11:4090655-4090677 CAGGAGTAAGTGGGGAAGGAAGG + Intronic
1078774461 11:14381463-14381485 GAGCAGTGCCCGGGGAACGAAGG + Intergenic
1079932242 11:26578585-26578607 GATCAGTTCCTGGGGAGTGAGGG + Intronic
1082608013 11:55265712-55265734 CATAAGTTCCTGGAGAAGGTAGG - Intronic
1082921018 11:58493726-58493748 CAGCAGGTCCTGGGATATGAAGG + Intergenic
1083343162 11:61971979-61972001 CAGCACATCCTGGAGCAGGAGGG + Intergenic
1083427991 11:62599164-62599186 CTGCAGCTCCTTGGGGAGGAAGG - Intronic
1083615760 11:64025432-64025454 CATCAGTTGCTGGGAGAGGAAGG - Intronic
1083637617 11:64128994-64129016 CAGGACTTCCTGGGGAAGGGTGG - Intronic
1083872793 11:65500502-65500524 CAGCAGTTCGTGGTGAAGATAGG + Intergenic
1084084729 11:66849794-66849816 CTGCAGATCCAGGGGAGGGAGGG + Exonic
1084494464 11:69495931-69495953 CAGGAGCTCCTGGGGCAGGTGGG + Intergenic
1084517143 11:69643224-69643246 CAGCAGCTCCTCGGGCCGGATGG - Exonic
1084667013 11:70582001-70582023 CAGCAGCTCCTAGGGGAGGCAGG - Intronic
1084860296 11:72013766-72013788 CGCCAGGTCCTGGAGAAGGAGGG - Exonic
1084951995 11:72671538-72671560 CAGCAGTCCCTGGGGACAGGAGG + Intronic
1084978450 11:72815811-72815833 CACCAGTTCCAGGGGAGGGTGGG - Intronic
1085196065 11:74672566-74672588 CAGTAGTTCCTGGGTGAGGCTGG - Intergenic
1085513781 11:77100759-77100781 CAGCAGTTCTTGGGGTAGAATGG - Intronic
1085652077 11:78277441-78277463 CAGCTGGTGCTGGGGAAAGACGG + Intronic
1086885267 11:92198381-92198403 CTGCAGGTCCTGCAGAAGGAGGG - Intergenic
1088245532 11:107814491-107814513 CAGGAGTTTGTGGGGAGGGAGGG + Intronic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1089126889 11:116182713-116182735 TAGCAGTGCCTCCGGAAGGAAGG + Intergenic
1089256631 11:117197691-117197713 CTGCTGTTCCTGGGGAGGTAAGG - Intergenic
1089278454 11:117355656-117355678 AGGGAGTTCCTGGGGAAGGTGGG + Intronic
1089400130 11:118159733-118159755 TAGGAGGTGCTGGGGAAGGAAGG - Intergenic
1089453475 11:118612390-118612412 CAGCATTTTCTGAGGGAGGAGGG - Intronic
1089534004 11:119149657-119149679 CAGCAGCCCCTGGGGACTGAAGG - Intronic
1089564477 11:119363711-119363733 CAGGAGACCCTGGGAAAGGAGGG + Intronic
1090038860 11:123272885-123272907 GAGCAATTCCTAGAGAAGGATGG - Intergenic
1091651631 12:2314507-2314529 CAGTGGTTCCTGGGGAAGGGAGG - Intronic
1091693819 12:2614693-2614715 CAGCATTTGCTGTGAAAGGATGG + Intronic
1093176217 12:15916232-15916254 AAGCAGTTCCTGAGGAAGTCTGG - Intronic
1095550664 12:43435005-43435027 CACCAGTTGTGGGGGAAGGAAGG + Intronic
1095604655 12:44052598-44052620 CAGCAGTGTCTGGGAAATGAGGG - Intronic
1096055926 12:48651861-48651883 CAGCACTTTCTGGGGAATGAGGG - Intergenic
1096077507 12:48814665-48814687 CTGCAGTTCCTGGAGAAAGGAGG + Intronic
1096186951 12:49587650-49587672 CAGCTGGTCCCGGGGAAGGCTGG + Exonic
1096416628 12:51420100-51420122 GAGCATTTCCTGTGGAAGGGAGG - Intronic
1096497138 12:52045201-52045223 CTGTAGTTCCTGGAGCAGGAGGG + Intronic
1097291771 12:57922635-57922657 CAGTAGTTATTGGGGAGGGAGGG + Intergenic
1098656948 12:73044061-73044083 CAGGAGTTCATGGGGAAGGAGGG + Intergenic
1098733115 12:74064229-74064251 GAGGTCTTCCTGGGGAAGGATGG - Intergenic
1100932426 12:99625222-99625244 CAGCAGACACTGGGGAGGGAAGG + Intronic
1101406788 12:104435843-104435865 CTGCAGCTCCTGGGCAAGGTGGG - Intergenic
1101741590 12:107504017-107504039 CAGCCCTTGCTGGGGAAGCAGGG - Intronic
1101817563 12:108157481-108157503 TAGCAGCTCCAGGGGTAGGAGGG - Intronic
1103004139 12:117408312-117408334 GAGCAGCTCCTGGGGAAGGAGGG - Intronic
1103289240 12:119830622-119830644 CAGATGTGCCTGGGGTAGGAGGG - Intronic
1103877312 12:124138381-124138403 GAACCGTTCTTGGGGAAGGAAGG - Intronic
1104080447 12:125425606-125425628 CAGGAGTTCAGGGAGAAGGAGGG - Intronic
1104830841 12:131750128-131750150 CCACAGTGTCTGGGGAAGGATGG + Intronic
1104849183 12:131863212-131863234 CAGTCGTGCCTGGGGAGGGAGGG + Intergenic
1105715878 13:23064416-23064438 CAGCATTTCCTTAGGATGGAAGG + Intergenic
1106569730 13:30915946-30915968 GAGCTGTTCCTGGGGTAGGGAGG - Intronic
1107092650 13:36498874-36498896 CACCAGTCCCTGGAGAAAGAAGG - Intergenic
1107556582 13:41520969-41520991 AAGCAGTCCCTGGGGAAGCGGGG + Intergenic
1107650045 13:42535844-42535866 CAGCATTTCTTGGGTAAAGATGG + Intergenic
1108879115 13:55087350-55087372 CAAAAGGTCTTGGGGAAGGAGGG - Intergenic
1111091604 13:83453592-83453614 CAGCAAGTTGTGGGGAAGGAGGG - Intergenic
1111234695 13:85393499-85393521 CAGGAGTTACTGGGGACTGAGGG + Intergenic
1112172252 13:96986013-96986035 TAACATGTCCTGGGGAAGGAAGG - Exonic
1112789058 13:102983532-102983554 CATCAGCTCCTGGGGAAACACGG - Intergenic
1113784574 13:112995709-112995731 CCCCCGTTCCTGTGGAAGGAGGG - Intronic
1113808306 13:113122654-113122676 CAGCTCTGCCTGGGGAAGGTGGG + Intergenic
1114196480 14:20481354-20481376 CACCAGTGGGTGGGGAAGGAAGG - Intergenic
1114650201 14:24279912-24279934 CTGTGGGTCCTGGGGAAGGATGG + Intergenic
1114896917 14:27002223-27002245 CAGGAGTTCCTAGGGAAGGAGGG + Intergenic
1117101021 14:52347803-52347825 CAGCTGTCTCTGGGGACGGAGGG + Intergenic
1117483327 14:56170156-56170178 GAGCAGTTGCTTTGGAAGGAAGG + Intronic
1118592915 14:67414344-67414366 CACCACAGCCTGGGGAAGGAAGG - Intergenic
1119182630 14:72614919-72614941 CAGGGGTGCCTGGGGAAGGGAGG - Intergenic
1119287015 14:73463508-73463530 CAACAGCTCCTGGGGAACCAAGG - Intronic
1119545461 14:75468563-75468585 GAGAGGTTCCAGGGGAAGGAAGG - Intronic
1120118278 14:80646036-80646058 CAGGAGTTAGTGGGGAAGGAGGG + Intronic
1120457446 14:84750468-84750490 CAGCAGTCTCTGGTGGAGGAAGG + Intergenic
1121509655 14:94502880-94502902 CTGGGGTTCCTGGGGCAGGAAGG - Intronic
1122282904 14:100634692-100634714 GAGCAGTTCCTGGGGGAAGCGGG + Intergenic
1122287733 14:100661864-100661886 CAGCTGGCCCTGAGGAAGGAAGG + Intergenic
1122542117 14:102504495-102504517 CTGCCCTTCCTGGGGCAGGAGGG + Exonic
1122910936 14:104827260-104827282 CCGCAGGTCCGCGGGAAGGAAGG + Intergenic
1125578834 15:40771929-40771951 GAGCAATCCCTGGTGAAGGAAGG + Exonic
1126546308 15:49878149-49878171 AAGCAGTTTCTGGGAAAAGATGG - Intronic
1126639665 15:50812076-50812098 CTGCAGTCCCTGGGCAATGAGGG + Intergenic
1126859596 15:52871041-52871063 CAGAAGTGCCTGGAGAAAGAAGG - Intergenic
1129146781 15:73655468-73655490 TAGCAGTGGCTAGGGAAGGAAGG - Intergenic
1129358975 15:75012593-75012615 CAGCACAGCCAGGGGAAGGATGG + Intronic
1129655830 15:77525321-77525343 CAGCAGTTCTCCTGGAAGGAGGG + Intergenic
1130965329 15:88693446-88693468 CAGCAGGCCCTGGGTCAGGAAGG - Intergenic
1131085866 15:89575446-89575468 CAGCAGTTCCTGGAGAGCGCGGG + Intergenic
1131282693 15:91033949-91033971 CACCAGTCTCTGGGGAAGGGAGG - Intergenic
1132358446 15:101191406-101191428 CAGGGGTTACAGGGGAAGGAAGG + Intronic
1132465775 16:76904-76926 CAGGACTTCCTGGGGAGGGAGGG - Intergenic
1132600939 16:772683-772705 CCGGAGCTCCTGGGGATGGATGG + Exonic
1133208593 16:4249506-4249528 CTGCAGGTCCTGGGCAGGGATGG - Intergenic
1135388454 16:22066757-22066779 CAACAAATCCTGGGGAAGGAAGG + Intronic
1135692896 16:24558252-24558274 CAGCAAATACTGGGGAAAGATGG + Intronic
1136043556 16:27598974-27598996 CAGCATAACCTGGGGAAGGATGG + Intronic
1136186595 16:28592132-28592154 CAGCCATGCCTGGGGGAGGAAGG + Exonic
1136189216 16:28605925-28605947 CAGCCATGCCTGGGGGAGGAAGG + Exonic
1136317816 16:29464449-29464471 CAGCCATGCCTGGGGGAGGAAGG - Exonic
1136432391 16:30203794-30203816 CAGCCATGCCTGGGGGAGGAAGG - Exonic
1136613420 16:31380789-31380811 GAGCAGGGCCTGGGGAAGGAGGG + Intronic
1137536698 16:49332702-49332724 CAGAGATTCCTGAGGAAGGAGGG + Intergenic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1137735448 16:50719995-50720017 TTGCAGTTCCTGGGGTAGGTTGG + Exonic
1137785324 16:51133535-51133557 ACGCAGTTCCTGGGGAGGGGTGG + Intergenic
1137989392 16:53138013-53138035 AATAAGTTCCTGGGGAAGGAGGG + Intronic
1139546855 16:67653543-67653565 CAGCAGCCCCGGGGGAGGGAGGG - Intronic
1139651898 16:68366378-68366400 CCCCAGGTGCTGGGGAAGGAAGG - Intronic
1140207461 16:72945496-72945518 CAGCTGCTCCAGGAGAAGGAGGG + Intronic
1140410565 16:74738285-74738307 GAGCAGTCCATGGGGGAGGAGGG + Intronic
1140692226 16:77495594-77495616 CAGCAGGTCCTGGTGCAGGCAGG + Intergenic
1140939044 16:79703849-79703871 CAGCTGTTCCTGAGGCAGGTAGG - Intergenic
1141103165 16:81212687-81212709 CAGCAGTGCCTTGGTGAGGAAGG + Intergenic
1141831086 16:86510338-86510360 CAGCAGCTCCTCGGGGAGGGCGG + Intergenic
1142172005 16:88627810-88627832 GAGCAGCTCCCGGGGGAGGAGGG + Intronic
1142201641 16:88763901-88763923 CAGGTGTGCCTGGGGCAGGATGG - Intronic
1142246674 16:88973362-88973384 CAGCAGGACCTGGAGAAGGCAGG + Intronic
1142978060 17:3656871-3656893 CGGCAGAGCCTGGGAAAGGAAGG + Intronic
1143301180 17:5911725-5911747 TTGCAGGTCCAGGGGAAGGAGGG + Intronic
1144410259 17:14993957-14993979 CAGAGGTTCTTGGGGAAGGATGG - Intergenic
1144583611 17:16474456-16474478 CAAGAGGTCCTGGGGAAGCAGGG - Intronic
1145311755 17:21704684-21704706 CTGCAGTCCCTGGGCAAGCAGGG + Intergenic
1145790500 17:27623803-27623825 CAGCTGTTCTTGGGGTAGGGCGG + Exonic
1146278729 17:31531486-31531508 CAGGAGATCCTGGGCAAGGTGGG - Intronic
1146956768 17:36940548-36940570 AAGCGGGTCCTGGGGGAGGAAGG + Intronic
1147055727 17:37833436-37833458 AAGCACTTCCGGTGGAAGGATGG + Intergenic
1147747657 17:42705175-42705197 CAGCAGGTGCTGGGGAAGAGGGG + Exonic
1148460565 17:47837012-47837034 AAGCTCTTTCTGGGGAAGGAAGG + Exonic
1148777095 17:50101947-50101969 CTGCAGGTCCTGGGGAGGGGTGG + Intronic
1149541404 17:57470732-57470754 CAGCAGCTCCTGCGGGTGGAAGG + Intronic
1149560467 17:57604703-57604725 CAGGGGATTCTGGGGAAGGAAGG + Intronic
1149949865 17:60974041-60974063 CAGCAGTTATTTGGGTAGGAGGG - Intronic
1151367986 17:73629556-73629578 CAGCATTTCCTAGGGAAGACGGG + Intronic
1151601351 17:75108205-75108227 GGGCAGTTCCTGGGCAGGGAGGG + Intergenic
1152154564 17:78624194-78624216 CAGCATTTCCTGGACAAAGACGG - Intergenic
1152475349 17:80514207-80514229 CTGCGGTTCCTGGGAGAGGAGGG - Intergenic
1152503421 17:80729167-80729189 CAGCAAAGCCTGGGGAAGTATGG - Intronic
1152593808 17:81228571-81228593 CATGACCTCCTGGGGAAGGAGGG + Exonic
1153522759 18:5967810-5967832 CAGGACTCCCTGGGGCAGGAGGG + Intronic
1153526686 18:6001496-6001518 CAGCAAACCCTGGGGAAGGCGGG + Intronic
1154492148 18:14930633-14930655 CAGCACTTCCTGGGTGTGGAAGG - Intergenic
1156263957 18:35469256-35469278 CCGCAGTTCTAGGGGAAGGGTGG - Intronic
1156312916 18:35941112-35941134 CAGCAGTCCCTGGGGCTGGCAGG + Intergenic
1156458496 18:37308008-37308030 CAGCAGGTCCTGGGCAGGGCAGG + Intronic
1156967682 18:43115383-43115405 CACCAAATGCTGGGGAAGGAGGG - Intronic
1157574169 18:48732638-48732660 CAGAAGGAGCTGGGGAAGGATGG - Intronic
1157590935 18:48836131-48836153 AAGCAGCTGCTGGGGGAGGAGGG - Intronic
1157627248 18:49060951-49060973 GAGCAGTTCCTGGGTAGTGAGGG + Intronic
1157681791 18:49613263-49613285 CAGCTTTTCCTGGTGATGGAGGG + Intergenic
1158476441 18:57784150-57784172 CTGAAGTTCCTGGGACAGGAAGG + Intronic
1159763433 18:72456448-72456470 CTTCACTCCCTGGGGAAGGAGGG - Intergenic
1160267894 18:77356404-77356426 AAGCAGATCATGGGGCAGGAAGG - Intergenic
1160434560 18:78836427-78836449 CAGCTGTGCCTGGGGACAGAAGG - Intergenic
1160975796 19:1791856-1791878 CAGCAGCTGGTGGGGGAGGAGGG + Exonic
1161666373 19:5579521-5579543 CAGCCAGCCCTGGGGAAGGAGGG - Intergenic
1162174796 19:8823029-8823051 CCGGAGTCCCCGGGGAAGGAGGG - Intronic
1162451877 19:10759866-10759888 CAGGAGTTGCTGGGGGCGGAGGG + Intronic
1163622225 19:18367823-18367845 CAGTAGTTTCTCGGCAAGGAGGG + Exonic
1164549084 19:29193245-29193267 TGGCACTTCCTGGGGGAGGAAGG - Intergenic
1164913283 19:32029298-32029320 CAGGAGTGGCTTGGGAAGGACGG - Intergenic
1165162634 19:33826747-33826769 CAGGGGTGCCTGGGGTAGGAGGG + Intergenic
1165188395 19:34041205-34041227 GAGCAGTTTCTGTGGAAGGATGG - Intergenic
1165251225 19:34537441-34537463 CAGCAAATCCAGGGGAAGGGGGG - Intergenic
1165545687 19:36533620-36533642 CAGCATTTCCTGTGGTGGGAGGG - Intergenic
1165901255 19:39170284-39170306 CAGCAGATGCTGGGGAAGCCGGG + Intronic
1166155613 19:40909272-40909294 CAGCACTTCCTGGGTGAGAAGGG - Intergenic
1166179197 19:41095037-41095059 CAGCACTTCCTGGATAAGAAGGG + Exonic
1166269819 19:41707083-41707105 CAGCTGAGCCCGGGGAAGGAGGG - Intronic
1166373686 19:42315638-42315660 CCCTAGTTCCTGGGGGAGGATGG + Intronic
1166695296 19:44848389-44848411 CAGCAGGTCCCGGGGAAGCCGGG + Intronic
1167489987 19:49786957-49786979 CAGCAGTGACTGGGGCACGAAGG + Intronic
1202677357 1_KI270711v1_random:19854-19876 CAGGAGTTCCTGGGTAAGAACGG - Intergenic
925277532 2:2661064-2661086 CAGCAGAGCCCGGGGAATGATGG + Intergenic
925507341 2:4583279-4583301 CAGCAGTGCCTGAATAAGGATGG + Intergenic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
926103127 2:10133351-10133373 CAGCAGTACCAGGTGAAGGGAGG - Intergenic
926103464 2:10135867-10135889 CATCAGTCCCTGGGGAGGCAGGG - Intergenic
926819910 2:16840647-16840669 CAGCAGTACCTGGGGGAAGAAGG - Intergenic
928572163 2:32620492-32620514 GAGAAGTCCTTGGGGAAGGATGG + Intergenic
929375875 2:41286415-41286437 CAGAAGTTCAAGGGGAAGGAGGG + Intergenic
929484712 2:42343020-42343042 CAGCACCTCCTGAGGTAGGAGGG - Intronic
929600234 2:43200039-43200061 CAGCTGTGGCTGGGAAAGGACGG - Intergenic
934564112 2:95329004-95329026 CAGCGGTTCCTAGGAAAGGTGGG + Intronic
936270101 2:111042713-111042735 CAGCAGTAGCTGGCCAAGGAAGG + Intronic
936397927 2:112143155-112143177 CAGGTGGTCATGGGGAAGGAAGG + Intronic
936451362 2:112636149-112636171 GAGCAGGTGCAGGGGAAGGAAGG + Intergenic
936973596 2:118197760-118197782 CACCAGCTCCTCGGCAAGGAGGG - Intergenic
937384168 2:121411777-121411799 CAGCACTTCCTAAGGAAGGTTGG - Intronic
937743321 2:125381512-125381534 CAGGCTTGCCTGGGGAAGGATGG + Intergenic
938175787 2:129127525-129127547 CAGCATTCCCTGAGGAAGGCAGG - Intergenic
938240549 2:129739416-129739438 CATCAGAACCTGGGGAAGGTAGG - Intergenic
938307607 2:130265890-130265912 CAGCAGCCCCTGGGGAATGCTGG - Intergenic
938447725 2:131390952-131390974 CAGCAGCCCCTGGGGAATGCTGG + Intergenic
938689678 2:133776157-133776179 CAGCAAGGCCTGGGGATGGAGGG + Intergenic
938996913 2:136689438-136689460 CAGTAGTTCCTTGGGAGGCAGGG - Intergenic
939065551 2:137479491-137479513 CAGCAGTTGCTGGGGAAAGTGGG + Intronic
940579105 2:155553522-155553544 TAGCATTTCCTGAGGAAAGAGGG + Intergenic
941864714 2:170322672-170322694 TAGCAGTTCCTGAGGAAGACTGG - Intronic
941983390 2:171485353-171485375 CAGCAGTTCCTGGGGAAGGAAGG - Intergenic
941984017 2:171491713-171491735 CAGGAGTTGCTGGTAAAGGAAGG + Intergenic
943713449 2:191123983-191124005 CAGCAGTTTCTAAGGATGGAAGG - Intronic
943932598 2:193873185-193873207 CAGGAGTTCCAGGGTAGGGATGG - Intergenic
945941526 2:215956185-215956207 CAGCAGTTCATGTGAAAGAAAGG + Intronic
945950752 2:216036343-216036365 CAGCAGATCATTGGGAATGATGG - Intronic
946079927 2:217108990-217109012 CGCCAGATCCTGGGTAAGGAGGG + Intergenic
946259743 2:218477519-218477541 CACCATTTCCTGGGAAAGAAAGG - Intronic
947385013 2:229582382-229582404 GAGCTCTTCCTGGGGAGGGATGG - Intronic
947664801 2:231897798-231897820 CAGCAGCTCCTGGGGACGCTCGG - Intergenic
948088973 2:235275314-235275336 GTGCATTTCCTGGGGAAGCAAGG + Intergenic
948160864 2:235822877-235822899 CAGCACATCCGAGGGAAGGATGG + Intronic
948516785 2:238509208-238509230 GAGCAGTGCCTGGGGCTGGAGGG + Intergenic
948628519 2:239285380-239285402 CTGCACTTCCTGGGTAAGGAAGG + Intronic
948789513 2:240370083-240370105 CAGCTGTGTCTGGGGGAGGAGGG + Intergenic
948810333 2:240472043-240472065 CAGCACGTCCTTGGGAAGGCAGG - Intergenic
948931420 2:241134844-241134866 CTGGAGTTCCTGGGGCAGGCTGG - Intronic
949019606 2:241734062-241734084 CAGCAGTTACTGCGTCAGGAGGG + Intergenic
1169074303 20:2751908-2751930 CAGCACTTCCTGGGGACAGGGGG - Exonic
1169252883 20:4073599-4073621 GAGCTGTTCTTGGGGATGGAGGG + Intronic
1170451180 20:16485583-16485605 CAGCTGTTCCTGGAGATGGGAGG - Intronic
1170678258 20:18502115-18502137 TGGCAGCTCCTGGGAAAGGAAGG + Intergenic
1172135110 20:32681475-32681497 CAGCTGGCTCTGGGGAAGGAAGG - Intergenic
1172510855 20:35500035-35500057 CAGAACATCCTGGGAAAGGAAGG - Exonic
1173135509 20:40435335-40435357 CAGCAAGCCCTAGGGAAGGAAGG + Intergenic
1175400927 20:58699445-58699467 CAGCCGTCCCTGGGGGAGAAGGG + Intronic
1175487583 20:59356488-59356510 CAGCAGATCCTTCAGAAGGAAGG + Intergenic
1175632563 20:60554577-60554599 GAGGAGTTTCAGGGGAAGGAAGG - Intergenic
1175690954 20:61065719-61065741 GCGGGGTTCCTGGGGAAGGATGG + Intergenic
1175691541 20:61069020-61069042 GCGGTGTTCCTGGGGAAGGATGG + Intergenic
1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG + Intergenic
1178243431 21:30928738-30928760 CACCTGTTCGGGGGGAAGGAGGG + Intergenic
1178375966 21:32067720-32067742 CACCTGTTCCTGCGGCAGGACGG + Intergenic
1178905432 21:36632397-36632419 CATCAGTTCCGGGAGAAGCAGGG - Intergenic
1179280738 21:39931729-39931751 CAGGAGTTCCTGGGTAAATAAGG + Intergenic
1179484022 21:41698067-41698089 CTGAGGTTCCTGGGGAGGGAAGG + Intergenic
1179500812 21:41807527-41807549 CAGCAGTGTGAGGGGAAGGAAGG - Intronic
1179567794 21:42260077-42260099 CAGCAGCTCATGGGGCAGGAAGG + Intronic
1179935604 21:44601936-44601958 CACCTGTTGCTGGGGAAGCAGGG - Exonic
1179951769 21:44712268-44712290 CAGCCCCTCCTGGGGATGGACGG - Intergenic
1179983917 21:44910777-44910799 CAGCATGTCCTGTGGAGGGAAGG + Exonic
1180703021 22:17791955-17791977 TAGCAGCCCCTGGGGATGGAAGG + Intronic
1181237645 22:21457382-21457404 CAGCATCTCCTGAGGAAGTAAGG + Intergenic
1182148836 22:28014384-28014406 TGGCAGCTCCTGGGGAGGGAAGG + Exonic
1182456450 22:30454038-30454060 CAGGAGTGCCTGGGGAAGCAAGG - Intronic
1182499629 22:30736996-30737018 CAGAAGTTCCTGTGGAAAAATGG - Intronic
1182526404 22:30923087-30923109 CTGCAGTTACTGGAGCAGGAAGG + Intergenic
1182994325 22:34798856-34798878 CTGCAGTAGCTGGGGGAGGAGGG + Intergenic
1183667434 22:39253847-39253869 CAGGAGGACCTGGGGAAGGAAGG - Intergenic
1183947682 22:41335981-41336003 CTGCTGGTCCTGGGAAAGGAAGG + Intronic
1184226806 22:43133478-43133500 CCGTAGAGCCTGGGGAAGGAAGG + Exonic
1184250319 22:43256500-43256522 CAGCAGGGGCTGGGTAAGGAAGG + Intronic
1184433518 22:44455789-44455811 CAGCAGGTCCTGGGGTGTGATGG - Intergenic
1184562737 22:45272799-45272821 CAGGAGTTCTTGTGGATGGAGGG - Intergenic
1184600345 22:45539578-45539600 CGGCAGGTCCTGGGGCAGGAAGG + Intronic
1184730133 22:46367254-46367276 CAGCAGTCCCTGAGGAGGGGAGG - Intronic
1184959794 22:47920737-47920759 CAGCAGAGGCTGGGAAAGGAAGG - Intergenic
1185223136 22:49639247-49639269 CAGAGGCTCCTGGGGAGGGAGGG + Intronic
1185294314 22:50045846-50045868 CAGGAGTTCCTGGGTAAGTGAGG - Exonic
950229595 3:11264944-11264966 CAGCAGTTCCCAGAGAAGCAAGG + Intergenic
950719793 3:14874882-14874904 CAGCTGGTCCTGGGGAAGCCAGG + Intronic
953768376 3:45761016-45761038 CAGCAGGTCCCAGGGAGGGAGGG - Intronic
953899404 3:46831040-46831062 GAGCAGTGCCTGGGGCAGGGAGG - Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954754694 3:52832801-52832823 CAGCAGCTTCTGTGGAAGGCAGG + Intronic
955935606 3:64099730-64099752 CAGCAGTACCAGGAGATGGAGGG - Exonic
955977058 3:64489558-64489580 CATGAGTTCCCGGGGAAGGTGGG + Intergenic
960516130 3:118604540-118604562 TGGGGGTTCCTGGGGAAGGATGG + Intergenic
960645675 3:119879628-119879650 GGGCAGTTGCTGGGGAAGTAGGG - Intronic
961488408 3:127233605-127233627 CAGCCGTTGCTGGGCAGGGAGGG + Intergenic
962251735 3:133840060-133840082 CAGCAGCCTCTAGGGAAGGAAGG + Intronic
962471624 3:135714117-135714139 CAGCAGCTCCAGGAGATGGATGG + Intergenic
962964823 3:140343900-140343922 CAGCAGCTCCTCGGTAAAGACGG - Intronic
962967225 3:140366203-140366225 CAGCAGTTTCTGGGAGGGGAGGG - Intronic
964672164 3:159238631-159238653 CAGAGGTTGCTGAGGAAGGAGGG + Intronic
966680367 3:182635839-182635861 CAGCTGATCTTGGGGAAGGCTGG - Intergenic
968468620 4:765850-765872 CAGAAGTTGCTGGGGGAAGACGG - Intronic
968592959 4:1468746-1468768 CATCAGTGCCTGTGGCAGGAGGG + Intergenic
968911645 4:3479539-3479561 GACCTGTCCCTGGGGAAGGAGGG - Intronic
969203292 4:5622696-5622718 CAGCAGATCCTGGAGGAGCACGG - Exonic
969314893 4:6376017-6376039 AGGCACCTCCTGGGGAAGGAGGG + Intronic
969444492 4:7236455-7236477 CAGGAGGTGCTGGGGCAGGAGGG + Intronic
969457158 4:7306647-7306669 AAGCTGGTCCTGGGGAAGGAGGG + Intronic
969880573 4:10170113-10170135 CAGCAGTTACTGGGGGGGGGGGG + Intergenic
969895330 4:10298632-10298654 CAGCAGTTACTGGGGGAATATGG + Intergenic
970429638 4:15976942-15976964 GAGCAGTGACTGGGGGAGGAGGG + Intronic
971267882 4:25110930-25110952 CAGCAGGCCCTGGGCATGGAAGG - Intergenic
972240116 4:37181593-37181615 CAGCAGCTCCTTGGGAGAGAAGG + Intergenic
972753346 4:42015779-42015801 CAGCAGTTTCTGGACAAGAATGG - Intronic
974435183 4:61847373-61847395 CAGCAGTGTATGGGGGAGGAGGG + Intronic
975291049 4:72678539-72678561 CAGCAGCCCCTGTGGAAGTAGGG + Intergenic
975654987 4:76632547-76632569 GAGCAATTACTGGGGATGGAGGG + Intronic
975781334 4:77843498-77843520 CAGCAGTCCTTGGGGATTGAAGG - Intergenic
976221661 4:82761189-82761211 CAGCAGTTCCTGAAGTTGGAAGG - Intronic
976888635 4:90016630-90016652 TATCACTTCCTGGGGGAGGAAGG - Intergenic
977180335 4:93866196-93866218 CAACATTGCCTGGGGGAGGAGGG - Intergenic
977208452 4:94190581-94190603 TAGCAGGGACTGGGGAAGGAGGG + Intergenic
978380503 4:108123343-108123365 CTGCAGTTCCCTGGGAAGGTAGG + Intronic
979076271 4:116275037-116275059 CAGCAGTGGCTGGGAAGGGAAGG - Intergenic
982990409 4:162266470-162266492 CAGCAGTTGTTGCAGAAGGATGG - Intergenic
984688590 4:182699382-182699404 CACGAGGTCCTGGGAAAGGAAGG - Intronic
985590242 5:760820-760842 CAGCGGTTCCTTGGGAGGGTGGG - Intronic
985616604 5:926769-926791 CAGCGTTTCCTGGGGAGGGAAGG + Intergenic
985876490 5:2602583-2602605 TAGCAGTTCCTGGGGCGAGAGGG - Intergenic
986438647 5:7759387-7759409 CATCTGTTGCTGGGGAAGGAGGG + Intronic
988126485 5:27045653-27045675 GAGCATTTCTTAGGGAAGGAAGG - Intronic
991107797 5:62862776-62862798 CAGCAGCACCTGGGGAGGGCGGG + Intergenic
991225829 5:64270424-64270446 CTGAAATTCCTGGGGAAGGAAGG - Intronic
991227126 5:64286013-64286035 AAGCAGTTCCTGGGGAAGGGGGG - Intronic
991295515 5:65076104-65076126 CTGCAGCTCCTGGGGAGGAAAGG + Intergenic
992204299 5:74415263-74415285 GAGCACTTTCTTGGGAAGGATGG + Intergenic
994355041 5:98785301-98785323 CAGCAGTTGGTGGGAAAGCACGG + Intronic
995972941 5:117994944-117994966 TAGCAGTTCAGGGGGATGGAGGG + Intergenic
997495844 5:134324680-134324702 CAGCAGTTCTGGGAGAGGGACGG + Intronic
998419642 5:141972201-141972223 CGCCAGGTCCTGGGGCAGGATGG - Intronic
1000168345 5:158677308-158677330 CAGGAGTCCTTGGGGCAGGAGGG - Intergenic
1000182712 5:158827755-158827777 TAGCAGTTTGTGGGGAAGAAGGG + Intronic
1001705260 5:173736994-173737016 CAGCAGGTCCGGGGGACAGATGG - Intergenic
1001839880 5:174866103-174866125 CAGCAAACCCTGAGGAAGGAAGG - Intergenic
1001924852 5:175628525-175628547 CAGCAGTGCATGGGTAAGGAGGG + Intergenic
1001937994 5:175719769-175719791 CACCAGATCCTGGGGAGGCAAGG - Intergenic
1002102171 5:176862977-176862999 CAGCAGTTTGGGGAGAAGGAGGG + Intronic
1002169117 5:177365711-177365733 CAGCAGGGGCTGGGGGAGGAGGG + Intronic
1002537607 5:179886136-179886158 CAGGAGTGCCAGGGGAAAGAAGG - Intronic
1002542564 5:179915748-179915770 CAGCACTTCCTGGGCAGGGAAGG - Intronic
1002716848 5:181233517-181233539 ACTCAGGTCCTGGGGAAGGAAGG - Intronic
1002799534 6:508448-508470 CGGGGGTTACTGGGGAAGGAGGG - Intronic
1002883167 6:1270870-1270892 CAGAATTCCTTGGGGAAGGATGG + Intergenic
1003241750 6:4351219-4351241 CAGGAGCTGCTGGGGAAGGAGGG - Intergenic
1003512434 6:6792549-6792571 GAGGAGTTGCTGGGGAGGGAGGG - Intergenic
1004194875 6:13494270-13494292 CAGCAGGGGCTTGGGAAGGATGG - Intergenic
1004296987 6:14422035-14422057 AGGCATTTCCTGGGGAAGAAGGG + Intergenic
1004408302 6:15355980-15356002 CAGAGGTTGCTGGGAAAGGAGGG - Intronic
1005114429 6:22319703-22319725 CAGTAGTTCCTGGTGGATGAAGG + Intergenic
1005954668 6:30655589-30655611 CAGCTGTACCTGGGACAGGAAGG + Exonic
1005994416 6:30922692-30922714 CTGCAGCACCTGGGGATGGAAGG - Exonic
1006367435 6:33623741-33623763 AAGCAGTTCCTGGGGCAGGAAGG - Intronic
1006634159 6:35450388-35450410 CTGCAGTTCATGGGGGTGGAGGG - Intergenic
1006919296 6:37616911-37616933 CAGCATTTCTGGAGGAAGGATGG - Intergenic
1007073907 6:39054765-39054787 CAGCAGCTGCTGGGGGTGGAGGG - Intronic
1007306293 6:40908027-40908049 CTGCAGTTGCTGGGAAAGGAAGG - Intergenic
1007500129 6:42290424-42290446 AAGCAGTTGCTGGGGAGGGCTGG - Intronic
1007619638 6:43204121-43204143 GAGCAGTGCCTGGGGCAGGAAGG - Intronic
1007662907 6:43497271-43497293 CAGACGTCCCTGGGGAAGGAGGG + Intronic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1007915898 6:45561405-45561427 CAGCAAGTCCTGGGAAAGGCAGG + Intronic
1008645783 6:53513205-53513227 CAGCTGTTTCAGGTGAAGGAAGG + Intronic
1009472409 6:64043989-64044011 CAGGAGTTGCAGGGGAAGGAAGG - Intronic
1010890721 6:81307086-81307108 CAGCAGTTCCTGCTCCAGGAAGG + Intergenic
1012374665 6:98547126-98547148 GAGCTGTTCCTGGGGAGTGAGGG - Intergenic
1012931973 6:105326984-105327006 CATCATTACCTGGGGAAGAAAGG - Intronic
1012971333 6:105734741-105734763 CAGCAGTTACTGCAGAGGGAGGG - Intergenic
1013237220 6:108207672-108207694 CAGCAGTTCAGGTGGATGGAAGG - Intergenic
1013863768 6:114668714-114668736 CAGGAGTTAGTGGTGAAGGAGGG - Intergenic
1015794416 6:136996894-136996916 CATCAGTTCCTTGGGACAGAAGG + Intergenic
1015937194 6:138415853-138415875 CAGCTCTTCATGGGGAAGGGTGG - Exonic
1017230083 6:152064273-152064295 CAGCAGCTGCGGAGGAAGGATGG + Intronic
1017949998 6:159128422-159128444 GAGAGGTTCCTGGGGAAGGCAGG - Intergenic
1018428420 6:163703886-163703908 CATCTGTTAATGGGGAAGGAGGG - Intergenic
1019061087 6:169258826-169258848 CAGGAGTTTCTGGGGCAGAAGGG - Intergenic
1019061737 6:169262360-169262382 CAGGAGTTTCTGGGGCAGAAAGG + Intergenic
1019722662 7:2582619-2582641 CAGCAGTGCAAGGAGAAGGACGG + Exonic
1020219759 7:6226733-6226755 CAGCAGAACCTGAGCAAGGAAGG + Intronic
1020361293 7:7329525-7329547 CAGCAGTGCCTGGGGGACAAAGG - Intergenic
1020719383 7:11722224-11722246 CTTCAGTTCCTGAGCAAGGAGGG - Intronic
1021216456 7:17921646-17921668 TAGCATTACCTGGGGAAGTAGGG + Intronic
1023601425 7:41885245-41885267 TAGCAGCTCCTGGAGAAGCAGGG + Intergenic
1023639366 7:42242030-42242052 AATAAGTTCCTAGGGAAGGAAGG - Intergenic
1023861399 7:44219566-44219588 CAGCAGAGCCTGGGGGTGGATGG - Intronic
1023872500 7:44270309-44270331 AAGCAGTGGCTGGGGAGGGATGG + Intronic
1024430812 7:49285897-49285919 CAGGACTTACTGAGGAAGGAGGG + Intergenic
1024568268 7:50702310-50702332 CGGCAGTGACTGGGGAAGCAGGG - Intronic
1024729511 7:52238825-52238847 CAGGTGTGCCTGGGGAAGGGTGG - Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1026052494 7:66959076-66959098 CAGCACCTGCTGGGGAGGGAAGG - Intergenic
1026983006 7:74537676-74537698 CTGCAGTTCCCTGGGAGGGAGGG + Intronic
1028657708 7:93229660-93229682 CACCAAATCCTGGGGAAGGTTGG - Intergenic
1028757323 7:94452679-94452701 GAGAAGTTCCTGGGGGAGGGGGG - Intergenic
1029356680 7:100057290-100057312 CTGGAGCTCCTGGGGCAGGATGG - Exonic
1029494235 7:100888695-100888717 CAGGAGTTACTCTGGAAGGATGG - Intergenic
1031978997 7:128112367-128112389 CAGCACTCCCTGGGCATGGAAGG + Intergenic
1032090838 7:128910719-128910741 CAGCAGGCGCTGGGGAAGGCGGG + Exonic
1032724731 7:134580287-134580309 CGGCATTTCCTTGGGAAGTAGGG + Intergenic
1033966008 7:146975887-146975909 CAGCAAATCCCAGGGAAGGATGG + Intronic
1034270649 7:149802106-149802128 CAGCAGCTCCTGGCGCTGGAAGG - Intergenic
1034285223 7:149879584-149879606 CAGCATCTCCTTGGGAAAGAGGG - Exonic
1034499202 7:151439395-151439417 CAGCCGTGCCTGGTGCAGGAAGG - Intronic
1034754369 7:153601198-153601220 CAGCAAACCCTGGGGAAGGTGGG + Intergenic
1034882915 7:154776038-154776060 CAGCAGTGGGTGGGGCAGGAGGG - Intronic
1034956745 7:155339681-155339703 CAGCAGTTCCCGTGGGAAGAAGG - Intergenic
1035127487 7:156619025-156619047 CAGCAGCAGCTGGGGAAGGAAGG + Intergenic
1035260416 7:157658478-157658500 GAGCTTTGCCTGGGGAAGGAGGG - Intronic
1035460284 7:159034405-159034427 AGGCAGTTCCCAGGGAAGGAGGG - Intronic
1036013322 8:4752796-4752818 CATCAGTACCTGGAGAAAGAAGG + Intronic
1036408572 8:8477743-8477765 CAGCAGATACTGGGGAAGGCAGG + Intergenic
1037713686 8:21377463-21377485 TAGGAGTTAGTGGGGAAGGAGGG + Intergenic
1038455157 8:27668053-27668075 CTGCAGCTCCTGGGCAATGAAGG + Intronic
1038976177 8:32698678-32698700 CACCAGTGCTTGGGGAAGAATGG + Intronic
1039182865 8:34886029-34886051 CAACAGATCTTGGGGGAGGAAGG - Intergenic
1039445647 8:37629799-37629821 CAGCAGATCCTGGAAAGGGATGG + Intergenic
1039616945 8:38962951-38962973 CACTAGTTCTTGGGAAAGGAGGG + Intronic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1041168956 8:55120874-55120896 CAGGAGTTTGTGGGGATGGAGGG - Intronic
1041238920 8:55832109-55832131 CAGCCAGCCCTGGGGAAGGAGGG + Intergenic
1041939926 8:63375613-63375635 TGACTGTTCCTGGGGAAGGAGGG - Intergenic
1042157429 8:65860450-65860472 CAGGAGTTCAAGGGGAGGGAGGG - Intergenic
1044759954 8:95507399-95507421 GAAGAGCTCCTGGGGAAGGATGG + Intergenic
1045811715 8:106228860-106228882 CAGGAGTTAGTAGGGAAGGAAGG - Intergenic
1046570119 8:115952769-115952791 CATCAGTCCTTGGGGTAGGAAGG - Intergenic
1050358311 9:4804218-4804240 CAGCAGTTCCTTGGGACCCAGGG + Intronic
1050453459 9:5808455-5808477 TAGCAGCTCCTGCTGAAGGAAGG - Intronic
1050682140 9:8124133-8124155 CAGCACTCCCAGAGGAAGGAGGG - Intergenic
1052139461 9:24961121-24961143 CAGGAGTTCGTAGGGAAGGAGGG + Intergenic
1053150823 9:35741618-35741640 AGGCAGGTCCTGGGGAAGGGAGG + Intronic
1056781524 9:89554630-89554652 GAGAAGCTCCTGGGGAAGGGAGG - Intergenic
1057443816 9:95099854-95099876 CACCAGTCCCAGGAGAAGGAAGG + Exonic
1059138908 9:111833685-111833707 CAGAAGTTCCAGGGGATGGCTGG - Intergenic
1060194831 9:121616891-121616913 CAGCAGTGCCTGGGGCAGCAGGG - Intronic
1061180293 9:129021556-129021578 CAGGACTTCCGGGGAAAGGAGGG - Intronic
1061239528 9:129361538-129361560 CTGGAGATCCTGGGGAAGTATGG - Intergenic
1062388787 9:136325959-136325981 CAGCAGCGCCTGGGGAAAGAGGG + Intergenic
1186257893 X:7742378-7742400 CTGCAGTCCCAGGGGAAGAAGGG + Intergenic
1187680525 X:21762769-21762791 CAGCATCTGCTGGGGAAGGAGGG - Intergenic
1189308364 X:40004148-40004170 AAGCAGTCCCTGAGGGAGGAAGG + Intergenic
1190304767 X:49075745-49075767 CGCCAGGTCCTGGGGTAGGAGGG + Exonic
1191863111 X:65682022-65682044 CACAAGTGCCTGGGGAGGGAGGG + Intronic
1192159214 X:68770211-68770233 AGGCAGTGCCTGGGGTAGGAGGG - Intergenic
1192214650 X:69150135-69150157 CTGCAGCTCCGGGGGCAGGAAGG + Intergenic
1194131927 X:90092082-90092104 CAACAGTTCCTGGGCCAAGAGGG - Intergenic
1194821605 X:98514202-98514224 CAGCAGAGCCTGGGGACAGATGG - Intergenic
1194846605 X:98817257-98817279 TAGAAGTTGATGGGGAAGGAGGG - Intergenic
1195003900 X:100668428-100668450 CAACAGTTCCTTTGGAAGCAAGG + Intronic
1195437731 X:104864761-104864783 GAGGTCTTCCTGGGGAAGGATGG - Intronic
1196027053 X:111052170-111052192 CAGCAGTTTCTGGAGATGGTGGG - Intronic
1198639722 X:138743370-138743392 CAGGGGTTGGTGGGGAAGGAGGG + Intronic
1198731288 X:139732492-139732514 CAGATGTTCCTGAGGAAGGGAGG + Intronic
1198779812 X:140222218-140222240 CAGCATGTCATGGGGAAGCAGGG - Intergenic
1200053473 X:153446614-153446636 CAGTGGCTGCTGGGGAAGGAAGG + Intronic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic
1201604555 Y:15770961-15770983 CAGGACTTCCGGGGAAAGGAGGG + Intergenic