ID: 941987296

View in Genome Browser
Species Human (GRCh38)
Location 2:171522317-171522339
Sequence CTCGGCGGCCGCGTGATCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941987289_941987296 -4 Left 941987289 2:171522298-171522320 CCACCAGGCAATGAGCGCCCTCG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 941987296 2:171522317-171522339 CTCGGCGGCCGCGTGATCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 57
941987291_941987296 -7 Left 941987291 2:171522301-171522323 CCAGGCAATGAGCGCCCTCGGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 941987296 2:171522317-171522339 CTCGGCGGCCGCGTGATCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941987296 Original CRISPR CTCGGCGGCCGCGTGATCCC GGG Intronic