ID: 941987296 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:171522317-171522339 |
Sequence | CTCGGCGGCCGCGTGATCCC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 63 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 57} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
941987289_941987296 | -4 | Left | 941987289 | 2:171522298-171522320 | CCACCAGGCAATGAGCGCCCTCG | 0: 1 1: 0 2: 0 3: 9 4: 70 |
||
Right | 941987296 | 2:171522317-171522339 | CTCGGCGGCCGCGTGATCCCGGG | 0: 1 1: 0 2: 0 3: 5 4: 57 |
||||
941987291_941987296 | -7 | Left | 941987291 | 2:171522301-171522323 | CCAGGCAATGAGCGCCCTCGGCG | 0: 1 1: 0 2: 0 3: 4 4: 41 |
||
Right | 941987296 | 2:171522317-171522339 | CTCGGCGGCCGCGTGATCCCGGG | 0: 1 1: 0 2: 0 3: 5 4: 57 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
941987296 | Original CRISPR | CTCGGCGGCCGCGTGATCCC GGG | Intronic | ||