ID: 941989092

View in Genome Browser
Species Human (GRCh38)
Location 2:171537381-171537403
Sequence GAGGAGAAAAAGCATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941989085_941989092 12 Left 941989085 2:171537346-171537368 CCCAGGAAACTAAAGAATTATGT No data
Right 941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG No data
941989086_941989092 11 Left 941989086 2:171537347-171537369 CCAGGAAACTAAAGAATTATGTA No data
Right 941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941989092 Original CRISPR GAGGAGAAAAAGCATGAGGA GGG Intronic
No off target data available for this crispr