ID: 941992875

View in Genome Browser
Species Human (GRCh38)
Location 2:171574230-171574252
Sequence TATCGGTAGTGCAGCCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941992875_941992881 19 Left 941992875 2:171574230-171574252 CCTCGCTGGCTGCACTACCGATA No data
Right 941992881 2:171574272-171574294 AACGTCACGGCCGCCAGCCCGGG No data
941992875_941992879 6 Left 941992875 2:171574230-171574252 CCTCGCTGGCTGCACTACCGATA No data
Right 941992879 2:171574259-171574281 ACGAGGTGGCAGCAACGTCACGG No data
941992875_941992877 -8 Left 941992875 2:171574230-171574252 CCTCGCTGGCTGCACTACCGATA No data
Right 941992877 2:171574245-171574267 TACCGATAATATGCACGAGGTGG No data
941992875_941992882 20 Left 941992875 2:171574230-171574252 CCTCGCTGGCTGCACTACCGATA No data
Right 941992882 2:171574273-171574295 ACGTCACGGCCGCCAGCCCGGGG No data
941992875_941992880 18 Left 941992875 2:171574230-171574252 CCTCGCTGGCTGCACTACCGATA No data
Right 941992880 2:171574271-171574293 CAACGTCACGGCCGCCAGCCCGG No data
941992875_941992884 29 Left 941992875 2:171574230-171574252 CCTCGCTGGCTGCACTACCGATA No data
Right 941992884 2:171574282-171574304 CCGCCAGCCCGGGGCCTCCACGG No data
941992875_941992885 30 Left 941992875 2:171574230-171574252 CCTCGCTGGCTGCACTACCGATA No data
Right 941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941992875 Original CRISPR TATCGGTAGTGCAGCCAGCG AGG (reversed) Intergenic