ID: 941992878

View in Genome Browser
Species Human (GRCh38)
Location 2:171574247-171574269
Sequence TGCCACCTCGTGCATATTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941992878_941992882 3 Left 941992878 2:171574247-171574269 CCGATAATATGCACGAGGTGGCA No data
Right 941992882 2:171574273-171574295 ACGTCACGGCCGCCAGCCCGGGG No data
941992878_941992881 2 Left 941992878 2:171574247-171574269 CCGATAATATGCACGAGGTGGCA No data
Right 941992881 2:171574272-171574294 AACGTCACGGCCGCCAGCCCGGG No data
941992878_941992880 1 Left 941992878 2:171574247-171574269 CCGATAATATGCACGAGGTGGCA No data
Right 941992880 2:171574271-171574293 CAACGTCACGGCCGCCAGCCCGG No data
941992878_941992889 22 Left 941992878 2:171574247-171574269 CCGATAATATGCACGAGGTGGCA No data
Right 941992889 2:171574292-171574314 GGGGCCTCCACGGGCGACTGAGG No data
941992878_941992884 12 Left 941992878 2:171574247-171574269 CCGATAATATGCACGAGGTGGCA No data
Right 941992884 2:171574282-171574304 CCGCCAGCCCGGGGCCTCCACGG No data
941992878_941992885 13 Left 941992878 2:171574247-171574269 CCGATAATATGCACGAGGTGGCA No data
Right 941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941992878 Original CRISPR TGCCACCTCGTGCATATTAT CGG (reversed) Intergenic