ID: 941992885

View in Genome Browser
Species Human (GRCh38)
Location 2:171574283-171574305
Sequence CGCCAGCCCGGGGCCTCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941992875_941992885 30 Left 941992875 2:171574230-171574252 CCTCGCTGGCTGCACTACCGATA No data
Right 941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG No data
941992878_941992885 13 Left 941992878 2:171574247-171574269 CCGATAATATGCACGAGGTGGCA No data
Right 941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941992885 Original CRISPR CGCCAGCCCGGGGCCTCCAC GGG Intergenic