ID: 942008525

View in Genome Browser
Species Human (GRCh38)
Location 2:171734559-171734581
Sequence CAGTAACACTGGAGGGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942008525_942008531 -10 Left 942008525 2:171734559-171734581 CCAACATCCCTCCAGTGTTACTG No data
Right 942008531 2:171734572-171734594 AGTGTTACTGTACAAAGGATGGG No data
942008525_942008532 6 Left 942008525 2:171734559-171734581 CCAACATCCCTCCAGTGTTACTG No data
Right 942008532 2:171734588-171734610 GGATGGGCCACCATAGAACATGG No data
942008525_942008535 27 Left 942008525 2:171734559-171734581 CCAACATCCCTCCAGTGTTACTG No data
Right 942008535 2:171734609-171734631 GGTGTTTTTATAAATGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942008525 Original CRISPR CAGTAACACTGGAGGGATGT TGG (reversed) Intronic
No off target data available for this crispr