ID: 942013177

View in Genome Browser
Species Human (GRCh38)
Location 2:171785392-171785414
Sequence CTGTATCCACCGATGTGATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942013176_942013177 1 Left 942013176 2:171785368-171785390 CCTGCAAACGTGGCTGTGGCGAG 0: 1
1: 0
2: 0
3: 6
4: 49
Right 942013177 2:171785392-171785414 CTGTATCCACCGATGTGATCAGG 0: 1
1: 0
2: 0
3: 3
4: 33
942013173_942013177 19 Left 942013173 2:171785350-171785372 CCAAATTTGTTTTCGATGCCTGC 0: 1
1: 0
2: 3
3: 10
4: 139
Right 942013177 2:171785392-171785414 CTGTATCCACCGATGTGATCAGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942013177 Original CRISPR CTGTATCCACCGATGTGATC AGG Exonic
901690877 1:10972608-10972630 CTGGATCAACCTATGTGACCTGG + Intronic
908884029 1:68767080-68767102 CTGGATCCACCCATGTGCTTAGG - Intergenic
916448281 1:164894315-164894337 CAGCATCCACCAATGTGAGCTGG + Intronic
916518935 1:165545844-165545866 CTGGAGCCACTGATGTAATCCGG + Intronic
918614547 1:186529683-186529705 CTGGATCCACCGCTGAGTTCAGG + Intergenic
919376863 1:196806016-196806038 TGGTATCAACCCATGTGATCTGG - Intergenic
919386567 1:196930898-196930920 TGGTATCAACCCATGTGATCTGG - Intronic
1073732846 10:106311030-106311052 ATGTATTCACCCATGTGAGCTGG + Intergenic
1079423214 11:20314512-20314534 CTGTTTCCCCTGAAGTGATCAGG - Intergenic
1088185713 11:107166864-107166886 CTTTTTCCACAGATGTGGTCAGG + Intergenic
1116023076 14:39484822-39484844 CTGTGTCCACTGATGGGACCAGG + Intergenic
1126399575 15:48255799-48255821 CTTTATCCACAGATGTGAACTGG + Exonic
1126867491 15:52952151-52952173 CTGTATCCACCTCTGTAATAAGG + Intergenic
1127597881 15:60504839-60504861 CTGTTCCCACCGATATGATGGGG + Intronic
1130972892 15:88747993-88748015 CTGTGTCCCACGATGTGAGCTGG - Intergenic
1151401111 17:73856753-73856775 CTCTCTCCACAGATGTAATCAGG + Intergenic
1153701610 18:7700267-7700289 CTGAATCCACCTAGGTGATAAGG + Intronic
1159817684 18:73096117-73096139 CTGCATCAACCCATATGATCAGG + Intergenic
1162779415 19:12999011-12999033 CTGTATCCAAGCATGTGCTCAGG - Intronic
942013177 2:171785392-171785414 CTGTATCCACCGATGTGATCAGG + Exonic
1171953944 20:31445169-31445191 CTGTATCCAGAGGTTTGATCAGG + Intronic
1173128034 20:40358270-40358292 CTGTATCAACTCAAGTGATCAGG - Intergenic
1179356901 21:40668287-40668309 CTGAATCCACTGATGTGAGTTGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961466419 3:127084642-127084664 ATGTGACCACCGATGTGACCTGG + Intergenic
985561441 5:588388-588410 CTGTACCCACCGCTGTGCTCTGG - Intergenic
992184501 5:74231266-74231288 CTGTAAACACCTATGTGTTCTGG - Intergenic
999548868 5:152661701-152661723 GTGGATCCACCAAAGTGATCTGG - Intergenic
1013216751 6:108034508-108034530 CTGTATACAATGATGTGATGTGG - Intergenic
1023488089 7:40708587-40708609 CTGCAAGCACCTATGTGATCAGG + Intronic
1026319152 7:69253956-69253978 CTGTATCCACTGCTGTCATTTGG + Intergenic
1034592556 7:152154511-152154533 CTGTATTCACAGATGTCAGCAGG - Intronic
1037303153 8:17474795-17474817 CTGTATCCATCAAGATGATCAGG + Intergenic
1040687261 8:49889910-49889932 GTGTATCAACAGATGTGAGCAGG + Intergenic
1050522645 9:6517558-6517580 CTGTATCCATTGATGTTTTCTGG + Intergenic
1062109728 9:134775370-134775392 CTGTCTCCACCGATAGCATCTGG + Intronic
1197813726 X:130475181-130475203 CTGTTTCCATCGATGTGATAAGG + Intergenic