ID: 942023839

View in Genome Browser
Species Human (GRCh38)
Location 2:171894001-171894023
Sequence CTGGGGGAGGGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5299
Summary {0: 1, 1: 0, 2: 62, 3: 610, 4: 4626}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023839_942023852 -3 Left 942023839 2:171894001-171894023 CCCTCCTCCTTCCCCTCCCCCAG 0: 1
1: 0
2: 62
3: 610
4: 4626
Right 942023852 2:171894021-171894043 CAGCCGGGCATCCCCTCCTCCGG 0: 1
1: 0
2: 3
3: 22
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023839 Original CRISPR CTGGGGGAGGGGAAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr