ID: 942023956

View in Genome Browser
Species Human (GRCh38)
Location 2:171894465-171894487
Sequence CGCGGCGCGTCGGGATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023956_942023967 26 Left 942023956 2:171894465-171894487 CCATGGGATCCCGACGCGCCGCG No data
Right 942023967 2:171894514-171894536 GGAAAGCCCCAGGTTTCCTAAGG No data
942023956_942023962 5 Left 942023956 2:171894465-171894487 CCATGGGATCCCGACGCGCCGCG No data
Right 942023962 2:171894493-171894515 GCCACAGCTAGGTCGCCGCCAGG No data
942023956_942023960 -6 Left 942023956 2:171894465-171894487 CCATGGGATCCCGACGCGCCGCG No data
Right 942023960 2:171894482-171894504 GCCGCGTGGTTGCCACAGCTAGG No data
942023956_942023964 16 Left 942023956 2:171894465-171894487 CCATGGGATCCCGACGCGCCGCG No data
Right 942023964 2:171894504-171894526 GTCGCCGCCAGGAAAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023956 Original CRISPR CGCGGCGCGTCGGGATCCCA TGG (reversed) Intronic