ID: 942023959

View in Genome Browser
Species Human (GRCh38)
Location 2:171894475-171894497
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023959_942023967 16 Left 942023959 2:171894475-171894497 CCGACGCGCCGCGTGGTTGCCAC No data
Right 942023967 2:171894514-171894536 GGAAAGCCCCAGGTTTCCTAAGG No data
942023959_942023972 28 Left 942023959 2:171894475-171894497 CCGACGCGCCGCGTGGTTGCCAC No data
Right 942023972 2:171894526-171894548 GTTTCCTAAGGCCTCTTAGTGGG No data
942023959_942023962 -5 Left 942023959 2:171894475-171894497 CCGACGCGCCGCGTGGTTGCCAC No data
Right 942023962 2:171894493-171894515 GCCACAGCTAGGTCGCCGCCAGG No data
942023959_942023964 6 Left 942023959 2:171894475-171894497 CCGACGCGCCGCGTGGTTGCCAC No data
Right 942023964 2:171894504-171894526 GTCGCCGCCAGGAAAGCCCCAGG No data
942023959_942023971 27 Left 942023959 2:171894475-171894497 CCGACGCGCCGCGTGGTTGCCAC No data
Right 942023971 2:171894525-171894547 GGTTTCCTAAGGCCTCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023959 Original CRISPR GTGGCAACCACGCGGCGCGT CGG (reversed) Intronic