ID: 942023961

View in Genome Browser
Species Human (GRCh38)
Location 2:171894483-171894505
Sequence ACCTAGCTGTGGCAACCACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023961_942023967 8 Left 942023961 2:171894483-171894505 CCGCGTGGTTGCCACAGCTAGGT No data
Right 942023967 2:171894514-171894536 GGAAAGCCCCAGGTTTCCTAAGG No data
942023961_942023964 -2 Left 942023961 2:171894483-171894505 CCGCGTGGTTGCCACAGCTAGGT No data
Right 942023964 2:171894504-171894526 GTCGCCGCCAGGAAAGCCCCAGG No data
942023961_942023972 20 Left 942023961 2:171894483-171894505 CCGCGTGGTTGCCACAGCTAGGT No data
Right 942023972 2:171894526-171894548 GTTTCCTAAGGCCTCTTAGTGGG No data
942023961_942023974 25 Left 942023961 2:171894483-171894505 CCGCGTGGTTGCCACAGCTAGGT No data
Right 942023974 2:171894531-171894553 CTAAGGCCTCTTAGTGGGTGTGG No data
942023961_942023971 19 Left 942023961 2:171894483-171894505 CCGCGTGGTTGCCACAGCTAGGT No data
Right 942023971 2:171894525-171894547 GGTTTCCTAAGGCCTCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023961 Original CRISPR ACCTAGCTGTGGCAACCACG CGG (reversed) Intronic