ID: 942023966

View in Genome Browser
Species Human (GRCh38)
Location 2:171894511-171894533
Sequence TAGGAAACCTGGGGCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023966_942023976 3 Left 942023966 2:171894511-171894533 CCAGGAAAGCCCCAGGTTTCCTA No data
Right 942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data
942023966_942023971 -9 Left 942023966 2:171894511-171894533 CCAGGAAAGCCCCAGGTTTCCTA No data
Right 942023971 2:171894525-171894547 GGTTTCCTAAGGCCTCTTAGTGG No data
942023966_942023972 -8 Left 942023966 2:171894511-171894533 CCAGGAAAGCCCCAGGTTTCCTA No data
Right 942023972 2:171894526-171894548 GTTTCCTAAGGCCTCTTAGTGGG No data
942023966_942023977 4 Left 942023966 2:171894511-171894533 CCAGGAAAGCCCCAGGTTTCCTA No data
Right 942023977 2:171894538-171894560 CTCTTAGTGGGTGTGGCTTTGGG No data
942023966_942023974 -3 Left 942023966 2:171894511-171894533 CCAGGAAAGCCCCAGGTTTCCTA No data
Right 942023974 2:171894531-171894553 CTAAGGCCTCTTAGTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023966 Original CRISPR TAGGAAACCTGGGGCTTTCC TGG (reversed) Intronic