ID: 942023967

View in Genome Browser
Species Human (GRCh38)
Location 2:171894514-171894536
Sequence GGAAAGCCCCAGGTTTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023963_942023967 -3 Left 942023963 2:171894494-171894516 CCACAGCTAGGTCGCCGCCAGGA No data
Right 942023967 2:171894514-171894536 GGAAAGCCCCAGGTTTCCTAAGG No data
942023956_942023967 26 Left 942023956 2:171894465-171894487 CCATGGGATCCCGACGCGCCGCG No data
Right 942023967 2:171894514-171894536 GGAAAGCCCCAGGTTTCCTAAGG No data
942023955_942023967 27 Left 942023955 2:171894464-171894486 CCCATGGGATCCCGACGCGCCGC No data
Right 942023967 2:171894514-171894536 GGAAAGCCCCAGGTTTCCTAAGG No data
942023961_942023967 8 Left 942023961 2:171894483-171894505 CCGCGTGGTTGCCACAGCTAGGT No data
Right 942023967 2:171894514-171894536 GGAAAGCCCCAGGTTTCCTAAGG No data
942023958_942023967 17 Left 942023958 2:171894474-171894496 CCCGACGCGCCGCGTGGTTGCCA No data
Right 942023967 2:171894514-171894536 GGAAAGCCCCAGGTTTCCTAAGG No data
942023959_942023967 16 Left 942023959 2:171894475-171894497 CCGACGCGCCGCGTGGTTGCCAC No data
Right 942023967 2:171894514-171894536 GGAAAGCCCCAGGTTTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023967 Original CRISPR GGAAAGCCCCAGGTTTCCTA AGG Intronic