ID: 942023968 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:171894520-171894542 |
Sequence | AAGAGGCCTTAGGAAACCTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
942023968_942023976 | -6 | Left | 942023968 | 2:171894520-171894542 | CCCCAGGTTTCCTAAGGCCTCTT | No data | ||
Right | 942023976 | 2:171894537-171894559 | CCTCTTAGTGGGTGTGGCTTTGG | No data | ||||
942023968_942023977 | -5 | Left | 942023968 | 2:171894520-171894542 | CCCCAGGTTTCCTAAGGCCTCTT | No data | ||
Right | 942023977 | 2:171894538-171894560 | CTCTTAGTGGGTGTGGCTTTGGG | No data | ||||
942023968_942023980 | 26 | Left | 942023968 | 2:171894520-171894542 | CCCCAGGTTTCCTAAGGCCTCTT | No data | ||
Right | 942023980 | 2:171894569-171894591 | AGCCAAAGTCGTTTTCCCCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
942023968 | Original CRISPR | AAGAGGCCTTAGGAAACCTG GGG (reversed) | Intronic | ||