ID: 942023969

View in Genome Browser
Species Human (GRCh38)
Location 2:171894521-171894543
Sequence TAAGAGGCCTTAGGAAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023969_942023976 -7 Left 942023969 2:171894521-171894543 CCCAGGTTTCCTAAGGCCTCTTA No data
Right 942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data
942023969_942023977 -6 Left 942023969 2:171894521-171894543 CCCAGGTTTCCTAAGGCCTCTTA No data
Right 942023977 2:171894538-171894560 CTCTTAGTGGGTGTGGCTTTGGG No data
942023969_942023980 25 Left 942023969 2:171894521-171894543 CCCAGGTTTCCTAAGGCCTCTTA No data
Right 942023980 2:171894569-171894591 AGCCAAAGTCGTTTTCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023969 Original CRISPR TAAGAGGCCTTAGGAAACCT GGG (reversed) Intronic