ID: 942023970

View in Genome Browser
Species Human (GRCh38)
Location 2:171894522-171894544
Sequence CTAAGAGGCCTTAGGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023970_942023980 24 Left 942023970 2:171894522-171894544 CCAGGTTTCCTAAGGCCTCTTAG No data
Right 942023980 2:171894569-171894591 AGCCAAAGTCGTTTTCCCCGAGG No data
942023970_942023977 -7 Left 942023970 2:171894522-171894544 CCAGGTTTCCTAAGGCCTCTTAG No data
Right 942023977 2:171894538-171894560 CTCTTAGTGGGTGTGGCTTTGGG No data
942023970_942023976 -8 Left 942023970 2:171894522-171894544 CCAGGTTTCCTAAGGCCTCTTAG No data
Right 942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023970 Original CRISPR CTAAGAGGCCTTAGGAAACC TGG (reversed) Intronic