ID: 942023972

View in Genome Browser
Species Human (GRCh38)
Location 2:171894526-171894548
Sequence GTTTCCTAAGGCCTCTTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023959_942023972 28 Left 942023959 2:171894475-171894497 CCGACGCGCCGCGTGGTTGCCAC No data
Right 942023972 2:171894526-171894548 GTTTCCTAAGGCCTCTTAGTGGG No data
942023961_942023972 20 Left 942023961 2:171894483-171894505 CCGCGTGGTTGCCACAGCTAGGT No data
Right 942023972 2:171894526-171894548 GTTTCCTAAGGCCTCTTAGTGGG No data
942023963_942023972 9 Left 942023963 2:171894494-171894516 CCACAGCTAGGTCGCCGCCAGGA No data
Right 942023972 2:171894526-171894548 GTTTCCTAAGGCCTCTTAGTGGG No data
942023958_942023972 29 Left 942023958 2:171894474-171894496 CCCGACGCGCCGCGTGGTTGCCA No data
Right 942023972 2:171894526-171894548 GTTTCCTAAGGCCTCTTAGTGGG No data
942023966_942023972 -8 Left 942023966 2:171894511-171894533 CCAGGAAAGCCCCAGGTTTCCTA No data
Right 942023972 2:171894526-171894548 GTTTCCTAAGGCCTCTTAGTGGG No data
942023965_942023972 -5 Left 942023965 2:171894508-171894530 CCGCCAGGAAAGCCCCAGGTTTC No data
Right 942023972 2:171894526-171894548 GTTTCCTAAGGCCTCTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023972 Original CRISPR GTTTCCTAAGGCCTCTTAGT GGG Intronic