ID: 942023974

View in Genome Browser
Species Human (GRCh38)
Location 2:171894531-171894553
Sequence CTAAGGCCTCTTAGTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023963_942023974 14 Left 942023963 2:171894494-171894516 CCACAGCTAGGTCGCCGCCAGGA No data
Right 942023974 2:171894531-171894553 CTAAGGCCTCTTAGTGGGTGTGG No data
942023965_942023974 0 Left 942023965 2:171894508-171894530 CCGCCAGGAAAGCCCCAGGTTTC No data
Right 942023974 2:171894531-171894553 CTAAGGCCTCTTAGTGGGTGTGG No data
942023961_942023974 25 Left 942023961 2:171894483-171894505 CCGCGTGGTTGCCACAGCTAGGT No data
Right 942023974 2:171894531-171894553 CTAAGGCCTCTTAGTGGGTGTGG No data
942023966_942023974 -3 Left 942023966 2:171894511-171894533 CCAGGAAAGCCCCAGGTTTCCTA No data
Right 942023974 2:171894531-171894553 CTAAGGCCTCTTAGTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023974 Original CRISPR CTAAGGCCTCTTAGTGGGTG TGG Intronic