ID: 942023976

View in Genome Browser
Species Human (GRCh38)
Location 2:171894537-171894559
Sequence CCTCTTAGTGGGTGTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023965_942023976 6 Left 942023965 2:171894508-171894530 CCGCCAGGAAAGCCCCAGGTTTC No data
Right 942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data
942023966_942023976 3 Left 942023966 2:171894511-171894533 CCAGGAAAGCCCCAGGTTTCCTA No data
Right 942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data
942023968_942023976 -6 Left 942023968 2:171894520-171894542 CCCCAGGTTTCCTAAGGCCTCTT No data
Right 942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data
942023969_942023976 -7 Left 942023969 2:171894521-171894543 CCCAGGTTTCCTAAGGCCTCTTA No data
Right 942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data
942023963_942023976 20 Left 942023963 2:171894494-171894516 CCACAGCTAGGTCGCCGCCAGGA No data
Right 942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data
942023970_942023976 -8 Left 942023970 2:171894522-171894544 CCAGGTTTCCTAAGGCCTCTTAG No data
Right 942023976 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023976 Original CRISPR CCTCTTAGTGGGTGTGGCTT TGG Intronic