ID: 942023977

View in Genome Browser
Species Human (GRCh38)
Location 2:171894538-171894560
Sequence CTCTTAGTGGGTGTGGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023969_942023977 -6 Left 942023969 2:171894521-171894543 CCCAGGTTTCCTAAGGCCTCTTA No data
Right 942023977 2:171894538-171894560 CTCTTAGTGGGTGTGGCTTTGGG No data
942023963_942023977 21 Left 942023963 2:171894494-171894516 CCACAGCTAGGTCGCCGCCAGGA No data
Right 942023977 2:171894538-171894560 CTCTTAGTGGGTGTGGCTTTGGG No data
942023968_942023977 -5 Left 942023968 2:171894520-171894542 CCCCAGGTTTCCTAAGGCCTCTT No data
Right 942023977 2:171894538-171894560 CTCTTAGTGGGTGTGGCTTTGGG No data
942023966_942023977 4 Left 942023966 2:171894511-171894533 CCAGGAAAGCCCCAGGTTTCCTA No data
Right 942023977 2:171894538-171894560 CTCTTAGTGGGTGTGGCTTTGGG No data
942023965_942023977 7 Left 942023965 2:171894508-171894530 CCGCCAGGAAAGCCCCAGGTTTC No data
Right 942023977 2:171894538-171894560 CTCTTAGTGGGTGTGGCTTTGGG No data
942023970_942023977 -7 Left 942023970 2:171894522-171894544 CCAGGTTTCCTAAGGCCTCTTAG No data
Right 942023977 2:171894538-171894560 CTCTTAGTGGGTGTGGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023977 Original CRISPR CTCTTAGTGGGTGTGGCTTT GGG Intronic