ID: 942023980

View in Genome Browser
Species Human (GRCh38)
Location 2:171894569-171894591
Sequence AGCCAAAGTCGTTTTCCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942023969_942023980 25 Left 942023969 2:171894521-171894543 CCCAGGTTTCCTAAGGCCTCTTA No data
Right 942023980 2:171894569-171894591 AGCCAAAGTCGTTTTCCCCGAGG No data
942023973_942023980 16 Left 942023973 2:171894530-171894552 CCTAAGGCCTCTTAGTGGGTGTG No data
Right 942023980 2:171894569-171894591 AGCCAAAGTCGTTTTCCCCGAGG No data
942023968_942023980 26 Left 942023968 2:171894520-171894542 CCCCAGGTTTCCTAAGGCCTCTT No data
Right 942023980 2:171894569-171894591 AGCCAAAGTCGTTTTCCCCGAGG No data
942023970_942023980 24 Left 942023970 2:171894522-171894544 CCAGGTTTCCTAAGGCCTCTTAG No data
Right 942023980 2:171894569-171894591 AGCCAAAGTCGTTTTCCCCGAGG No data
942023975_942023980 9 Left 942023975 2:171894537-171894559 CCTCTTAGTGGGTGTGGCTTTGG No data
Right 942023980 2:171894569-171894591 AGCCAAAGTCGTTTTCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942023980 Original CRISPR AGCCAAAGTCGTTTTCCCCG AGG Intronic