ID: 942028692

View in Genome Browser
Species Human (GRCh38)
Location 2:171936579-171936601
Sequence AGAATTGGACTGCTGTTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942028688_942028692 -1 Left 942028688 2:171936557-171936579 CCCAGTGATAAGGGAATTTTTAA No data
Right 942028692 2:171936579-171936601 AGAATTGGACTGCTGTTAATGGG No data
942028689_942028692 -2 Left 942028689 2:171936558-171936580 CCAGTGATAAGGGAATTTTTAAG No data
Right 942028692 2:171936579-171936601 AGAATTGGACTGCTGTTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942028692 Original CRISPR AGAATTGGACTGCTGTTAAT GGG Intronic
No off target data available for this crispr